5UQW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5uqw by Molmil](/molmil-images/mine/5uqw) | Crystal structure of human KRAS G12V mutant in complex with GDP | Descriptor: | GTPase KRas, GUANOSINE-5'-DIPHOSPHATE, MAGNESIUM ION | Authors: | Huang, C.S, Kaplan, A, Stockwell, B.R, Tong, L. | Deposit date: | 2017-02-08 | Release date: | 2017-03-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Multivalent Small-Molecule Pan-RAS Inhibitors. Cell, 168, 2017
|
|
1QIZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qiz by Molmil](/molmil-images/mine/1qiz) | HUMAN INSULIN HEXAMERS WITH CHAIN B HIS MUTATED TO TYR COMPLEXED WITH RESORCINOL | Descriptor: | CHLORIDE ION, INSULIN A CHAIN, INSULIN B CHAIN, ... | Authors: | Tang, L, Whittingham, J.L, Verma, C.S, Caves, L.S.D, Dodson, G.G. | Deposit date: | 1999-06-18 | Release date: | 1999-06-22 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Structural Consequences of the B5 Histidine --> Tyrosine Mutation in Human Insulin Characterized by X-Ray Crystallography and Conformational Analysis. Biochemistry, 38, 1999
|
|
1QN6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qn6 by Molmil](/molmil-images/mine/1qn6) | Crystal structure of the T(-26) Adenovirus major late promoter TATA box variant bound to wild-type TBP (Arabidopsis thaliana TBP isoform 2). TATA element recognition by the TATA box-binding protein has been conserved throughout evolution. | Descriptor: | DNA (5'-D(*GP*CP*TP*AP*TP*AP*AP*TP*AP*GP*GP*GP*CP*A)-3'), DNA (5'-D(*TP*GP*CP*CP*CP*TP*AP*TP*TP*AP*TP*AP*GP*C)-3'), TRANSCRIPTION INITIATION FACTOR TFIID-1 | Authors: | Patikoglou, G.A, Kim, J.L, Sun, L, Yang, S.-H, Kodadek, T, Burley, S.K. | Deposit date: | 1999-10-14 | Release date: | 2000-02-07 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | TATA Element Recognition by the TATA Box-Binding Protein Has Been Conserved Throughout Evolution Genes Dev., 13, 1999
|
|
1QES
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qes by Molmil](/molmil-images/mine/1qes) | TANDEM GU MISMATCHES IN RNA, NMR, 30 STRUCTURES | Descriptor: | RNA (5'-R(*GP*GP*AP*GP*UP*UP*CP*C)-3') | Authors: | Mcdowell, J.A, He, L, Chen, X, Turner, D.H. | Deposit date: | 1997-03-04 | Release date: | 1997-06-05 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Investigation of the structural basis for thermodynamic stabilities of tandem GU wobble pairs: NMR structures of (rGGAGUUCC)2 and (rGGAUGUCC)2. Biochemistry, 36, 1997
|
|
5ULB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ulb by Molmil](/molmil-images/mine/5ulb) | |
1JIV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1jiv by Molmil](/molmil-images/mine/1jiv) | T4 phage BGT in complex with Mg2+ : Form II | Descriptor: | DNA BETA-GLUCOSYLTRANSFERASE, MAGNESIUM ION, URIDINE-5'-DIPHOSPHATE | Authors: | Morera, S, Lariviere, L, Kurzeck, J, Aschke-Sonnenborn, U, Freemont, P.S, Janin, J, Ruger, W. | Deposit date: | 2001-07-03 | Release date: | 2001-08-15 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.07 Å) | Cite: | High resolution crystal structures of T4 phage beta-glucosyltransferase: induced fit and effect of substrate and metal binding. J.Mol.Biol., 311, 2001
|
|
1QPU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qpu by Molmil](/molmil-images/mine/1qpu) | SOLUTION STRUCTURE OF OXIDIZED ESCHERICHIA COLI CYTOCHROME B562 | Descriptor: | CYTOCHROME B562, PROTOPORPHYRIN IX CONTAINING FE | Authors: | Arnesano, F, Banci, L, Bertini, I, Faraone-Mennella, J, Rosato, A, Barker, P.D, Fersht, A.R. | Deposit date: | 1999-05-30 | Release date: | 1999-06-02 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | The solution structure of oxidized Escherichia coli cytochrome b562. Biochemistry, 38, 1999
|
|
1JLN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1jln by Molmil](/molmil-images/mine/1jln) | Crystal structure of the catalytic domain of protein tyrosine phosphatase PTP-SL/BR7 | Descriptor: | Protein Tyrosine Phosphatase, receptor type, R | Authors: | Szedlacsek, S.E, Aricescu, A.R, Fulga, T.A, Renault, L, Scheidig, A.J. | Deposit date: | 2001-07-16 | Release date: | 2001-08-17 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.81 Å) | Cite: | Crystal structure of PTP-SL/PTPBR7 catalytic domain: implications for MAP kinase regulation. J.Mol.Biol., 311, 2001
|
|
1QNA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qna by Molmil](/molmil-images/mine/1qna) | Crystal structure of the T(-30) Adenovirus major late promoter TATA box variant bound to wild-type TBP (Arabidopsis thaliana TBP isoform 2). TATA element recognition by the TATA box-binding protein has been conserved throughout evolution. | Descriptor: | DNA (5'-D(*GP*CP*TP*TP*TP*AP*AP*AP*AP*GP*GP*GP*CP*A)-3'), DNA (5'-D(*TP*GP*CP*CP*CP*TP*TP*TP*TP*AP*AP*AP*GP*C)-3'), TRANSCRIPTION INITIATION FACTOR TFIID-1 | Authors: | Patikoglou, G.A, Kim, J.L, Sun, L, Yang, S.-H, Kodadek, T, Burley, S.K. | Deposit date: | 1999-10-14 | Release date: | 2000-02-07 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | TATA Element Recognition by the TATA Box-Binding Protein Has Been Conserved Throughout Evolution Genes Dev., 13, 1999
|
|
1QF4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qf4 by Molmil](/molmil-images/mine/1qf4) | DESIGN, SYNTHESIS, AND X-RAY CRYSTAL STRUCTURE OF AN ENZYME BOUND BISUBSTRATE HYBRID INHIBITOR OF ADENYLOSUCCINATE SYNTHETASE | Descriptor: | (C8-R)-HYDANTOCIDIN 5'-PHOSPHATE, GUANOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, ... | Authors: | Hanessian, S, Lu, P.-P, Sanceau, J.-Y, Chemla, P, Gohda, K, Fonne-Pfister, R, Prade, L, Cowan-Jacob, S.W. | Deposit date: | 1999-04-06 | Release date: | 1999-12-02 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | An enzyme-bound bisubstrate hybrid inhibitor of adenylosuccinate synthetase Angew.Chem.Int.Ed.Engl., 38, 1999
|
|
1JY3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1jy3 by Molmil](/molmil-images/mine/1jy3) | Crystal Structure of the Central Region of Bovine Fibrinogen (E5 Fragment) at 1.4 Angstroms Resolution | Descriptor: | FIBRINOGEN ALPHA CHAIN, FIBRINOGEN BETA CHAIN, FIBRINOGEN GAMMA-B CHAIN | Authors: | Madrazo, J, Brown, J.H, Litvinovich, S, Dominguez, R, Yakovlev, S, Medved, L, Cohen, C. | Deposit date: | 2001-09-10 | Release date: | 2001-10-17 | Last modified: | 2017-10-04 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Crystal structure of the central region of bovine fibrinogen (E5 fragment) at 1.4-A resolution. Proc.Natl.Acad.Sci.USA, 98, 2001
|
|
5UXQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5uxq by Molmil](/molmil-images/mine/5uxq) | Structure of anti-HIV trimer apex antibody PGT143 | Descriptor: | PGT143 Fab Heavy Chain, PGT143 Fab Light Chain | Authors: | Kong, L, Wilson, I.A. | Deposit date: | 2017-02-23 | Release date: | 2017-04-19 | Last modified: | 2019-12-11 | Method: | X-RAY DIFFRACTION (2.415 Å) | Cite: | A Broadly Neutralizing Antibody Targets the Dynamic HIV Envelope Trimer Apex via a Long, Rigidified, and Anionic Beta-Hairpin Structure Immunity, 46, 2017
|
|
1Q7E
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1q7e by Molmil](/molmil-images/mine/1q7e) | Crystal Structure of YfdW protein from E. coli | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, Hypothetical protein yfdW, METHIONINE | Authors: | Gogos, A, Gorman, J, Shapiro, L, Burley, S.K, New York SGX Research Center for Structural Genomics (NYSGXRC) | Deposit date: | 2003-08-18 | Release date: | 2003-09-30 | Last modified: | 2021-02-03 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Structure of Escherichia coli YfdW, a type III CoA transferase. Acta Crystallogr.,Sect.D, 60, 2004
|
|
5UZE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5uze by Molmil](/molmil-images/mine/5uze) | Crystal Structure of Inosine 5'-monophosphate Dehydrogenase from Clostridium perfringens Complexed with IMP and P182 | Descriptor: | GLYCEROL, INOSINIC ACID, Inosine-5'-monophosphate dehydrogenase,Inosine-5'-monophosphate dehydrogenase, ... | Authors: | Maltseva, N, Kim, Y, Mulligan, R, Makowska-Grzyska, M, Gu, M, Gollapalli, D.R, Hedstrom, L, Joachimiak, A, Anderson, W.F, Center for Structural Genomics of Infectious Diseases (CSGID) | Deposit date: | 2017-02-26 | Release date: | 2017-03-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.27 Å) | Cite: | Crystal Structure of Inosine 5'-monophosphate Dehydrogenase from
Clostridium perfringens
Complexed with IMP and P182 To Be Published
|
|
1QJ0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qj0 by Molmil](/molmil-images/mine/1qj0) | HUMAN INSULIN HEXAMERS WITH CHAIN B HIS MUTATED TO TYR | Descriptor: | CHLORIDE ION, INSULIN A CHAIN, INSULIN B CHAIN, ... | Authors: | Tang, L, Whittingham, J.L, Verma, C.S, Caves, L.S.D, Dodson, G.G. | Deposit date: | 1999-06-18 | Release date: | 1999-06-22 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structural Consequences of the B5 Histidine --> Tyrosine Mutation in Human Insulin Characterized by X-Ray Crystallography and Conformational Analysis. Biochemistry, 38, 1999
|
|
5V0L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5v0l by Molmil](/molmil-images/mine/5v0l) | Crystal structure of the AHR-ARNT heterodimer in complex with the DRE | Descriptor: | Aryl hydrocarbon receptor, Aryl hydrocarbon receptor nuclear translocator, CITRIC ACID, ... | Authors: | Seok, S.-H, Lee, W, Jiang, L, Bradfield, C.A, Xing, Y. | Deposit date: | 2017-02-28 | Release date: | 2017-04-19 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (4 Å) | Cite: | Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex. Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
1K0O
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1k0o by Molmil](/molmil-images/mine/1k0o) | Crystal structure of a soluble form of CLIC1. An intracellular chloride ion channel | Descriptor: | CHLORIDE INTRACELLULAR CHANNEL PROTEIN 1 | Authors: | Harrop, S.J, DeMaere, M.Z, Fairlie, W.D, Reztsova, T, Valenzuela, S.M, Mazzanti, M, Tonini, R, Qiu, M.R, Jankova, L, Warton, K, Bauskin, A.R, Wu, W.M, Pankhurst, S, Campbell, T.J, Breit, S.N, Curmi, P.M.G. | Deposit date: | 2001-09-19 | Release date: | 2001-12-12 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (1.75 Å) | Cite: | Crystal structure of a soluble form of the intracellular chloride ion channel CLIC1 (NCC27) at 1.4-A resolution. J.Biol.Chem., 276, 2001
|
|
5W0B
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5w0b by Molmil](/molmil-images/mine/5w0b) | Structure of human TUT7 catalytic module (CM) | Descriptor: | IODIDE ION, SULFATE ION, Terminal uridylyltransferase 7, ... | Authors: | Faehnle, C.R, Walleshauser, J, Joshua-Tor, L. | Deposit date: | 2017-05-30 | Release date: | 2017-06-28 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.614 Å) | Cite: | Multi-domain utilization by TUT4 and TUT7 in control of let-7 biogenesis. Nat. Struct. Mol. Biol., 24, 2017
|
|
1JZL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1jzl by Molmil](/molmil-images/mine/1jzl) | Crystal structure of Sapharca inaequivalvis HbI, I114M mutant ligated to carbon monoxide. | Descriptor: | CARBON MONOXIDE, GLOBIN I - ARK SHELL, PROTOPORPHYRIN IX CONTAINING FE | Authors: | Knapp, J.E, Gibson, Q.H, Cushing, L, Royer Jr, W.E. | Deposit date: | 2001-09-16 | Release date: | 2001-12-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Restricting the Ligand-Linked Heme Movement in Scapharca Dimeric Hemoglobin Reveals Tight Coupling between Distal and Proximal
Contributions to Cooperativity. Biochemistry, 40, 2001
|
|
1QN3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qn3 by Molmil](/molmil-images/mine/1qn3) | Crystal structure of the C(-25) Adenovirus major late promoter TATA box variant bound to wild-type TBP (Arabidopsis thaliana TBP isoform 2). TATA element recognition by the TATA box-binding protein has been conserved throughout evolution. | Descriptor: | DNA (5'-D(*GP*CP*TP*AP*TP*AP*AP*AP*CP*GP*GP*GP*CP*A)-3'), DNA (5'-D(*TP*GP*CP*CP*CP*GP*TP*TP*TP*AP*TP*AP*GP*C)-3'), TRANSCRIPTION INITIATION FACTOR TFIID-1 | Authors: | Patikoglou, G.A, Kim, J.L, Sun, L, Yang, S.-H, Kodadek, T, Burley, S.K. | Deposit date: | 1999-10-14 | Release date: | 2000-02-06 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (1.95 Å) | Cite: | TATA Element Recognition by the TATA Box-Binding Protein Has Been Conserved Throughout Evolution Genes Dev., 13, 1999
|
|
5W0Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5w0z by Molmil](/molmil-images/mine/5w0z) | |
1QN7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qn7 by Molmil](/molmil-images/mine/1qn7) | Crystal structure of the T(-27) Adenovirus major late promoter TATA box variant bound to wild-type TBP (Arabidopsis thaliana TBP isoform 2). TATA element recognition by the TATA box-binding protein has been conserved throughout evolution. | Descriptor: | DNA (5'-D(*GP*CP*TP*AP*TP*AP*TP*AP*AP*GP*GP*GP*CP*A)-3'), DNA (5'-D(*TP*GP*CP*CP*CP*TP*TP*AP*TP*AP*TP*AP*GP*C)-3'), TRANSCRIPTION INITIATION FACTOR TFIID-1 | Authors: | Patikoglou, G.A, Kim, J.L, Sun, L, Yang, S.-H, Kodadek, T, Burley, S.K. | Deposit date: | 1999-10-14 | Release date: | 2000-02-07 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | TATA Element Recognition by the TATA Box-Binding Protein Has Been Conserved Throughout Evolution Genes Dev., 13, 1999
|
|
5VJI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5vji by Molmil](/molmil-images/mine/5vji) | Crystal structure of the CLOCK Transcription Domain Exon19 in Complex with a Repressor | Descriptor: | CLOCK-interacting pacemaker, Circadian locomoter output cycles protein kaput | Authors: | Hou, Z, Su, L, Pei, J, Grishin, N.V, Zhang, H. | Deposit date: | 2017-04-19 | Release date: | 2017-06-07 | Last modified: | 2020-01-01 | Method: | X-RAY DIFFRACTION (1.86 Å) | Cite: | Crystal Structure of the CLOCK Transactivation Domain Exon19 in Complex with a Repressor. Structure, 25, 2017
|
|
1QWA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwa by Molmil](/molmil-images/mine/1qwa) | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Descriptor: | 18S ribosomal RNA, 5'ETS | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | Deposit date: | 2003-09-01 | Release date: | 2003-11-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
|
|
5VDN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5vdn by Molmil](/molmil-images/mine/5vdn) | 1.55 Angstrom Resolution Crystal Structure of Glutathione Reductase from Yersinia pestis in Complex with FAD | Descriptor: | FLAVIN-ADENINE DINUCLEOTIDE, GLYCEROL, Glutathione oxidoreductase, ... | Authors: | Minasov, G, Shuvalova, L, Dubrovska, I, Cardona-Correa, A, Grimshaw, S, Kwon, K, Anderson, W.F, Center for Structural Genomics of Infectious Diseases (CSGID) | Deposit date: | 2017-04-03 | Release date: | 2017-04-19 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (1.55 Å) | Cite: | 1.55 Angstrom Resolution Crystal Structure of Glutathione Reductase from Yersinia pestis in Complex with FAD. To Be Published
|
|