8C9D
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8c9d by Molmil](/molmil-images/mine/8c9d) | Priestia megaterium W130Q mutant of type 2 isoleucyl-tRNA synthetase complexed with an isoleucyl-adenylate analogue | Descriptor: | D(-)-TARTARIC ACID, Isoleucine--tRNA ligase, N-[ISOLEUCINYL]-N'-[ADENOSYL]-DIAMINOSUFONE, ... | Authors: | Brkic, A, Leibundgut, M, Jablonska, J, Zanki, V, Car, Z, Petrovic Perokovic, V, Ban, N, Gruic-Sovulj, I. | Deposit date: | 2023-01-21 | Release date: | 2023-08-16 | Last modified: | 2024-03-27 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Antibiotic hyper-resistance in a class I aminoacyl-tRNA synthetase with altered active site signature motif. Nat Commun, 14, 2023
|
|
8C9F
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8c9f by Molmil](/molmil-images/mine/8c9f) | Priestia megaterium inactive HIGH motif mutant of type1 isoleucyl-tRNA synthetase complexed with an isoleucyl-adenylate analogue. | Descriptor: | CHLORIDE ION, Isoleucine--tRNA ligase, LITHIUM ION, ... | Authors: | Brkic, A, Leibundgut, M, Jablonska, J, Zanki, V, Car, Z, Petrovic Perokovic, V, Ban, N, Gruic-Sovulj, I. | Deposit date: | 2023-01-21 | Release date: | 2023-08-16 | Last modified: | 2024-03-27 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Antibiotic hyper-resistance in a class I aminoacyl-tRNA synthetase with altered active site signature motif. Nat Commun, 14, 2023
|
|
8C8V
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8c8v by Molmil](/molmil-images/mine/8c8v) | Priestia megaterium mupirocin-resistant isoleucyl-tRNA synthetase 2 with a fully-resolved C-terminal tRNA-binding domain complexed with an isoleucyl-adenylate analogue | Descriptor: | D(-)-TARTARIC ACID, Isoleucine--tRNA ligase, N-[ISOLEUCINYL]-N'-[ADENOSYL]-DIAMINOSUFONE, ... | Authors: | Brkic, A, Leibundgut, M, Jablonska, J, Zanki, V, Car, Z, Petrovic Perokovic, V, Ban, N, Gruic-Sovulj, I. | Deposit date: | 2023-01-21 | Release date: | 2023-08-16 | Last modified: | 2024-03-27 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Antibiotic hyper-resistance in a class I aminoacyl-tRNA synthetase with altered active site signature motif. Nat Commun, 14, 2023
|
|
8C9E
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8c9e by Molmil](/molmil-images/mine/8c9e) | Priestia megaterium mupirocin-sensitive isoleucyl-tRNA synthetase 1 complexed with an isoleucyl-adenylate analogue | Descriptor: | CHLORIDE ION, Isoleucine--tRNA ligase, LITHIUM ION, ... | Authors: | Brkic, A, Leibundgut, M, Jablonska, J, Zanki, V, Car, Z, Petrovic Perokovic, V, Ban, N, Gruic-Sovulj, I. | Deposit date: | 2023-01-21 | Release date: | 2023-08-16 | Last modified: | 2024-03-27 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Antibiotic hyper-resistance in a class I aminoacyl-tRNA synthetase with altered active site signature motif. Nat Commun, 14, 2023
|
|
1FG0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1fg0 by Molmil](/molmil-images/mine/1fg0) | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1FFZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ffz by Molmil](/molmil-images/mine/1ffz) | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
6SJ9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6sj9 by Molmil](/molmil-images/mine/6sj9) | Proteasome accessory factor B/C (PafBC) of Arthrobacter aurescens | Descriptor: | DI(HYDROXYETHYL)ETHER, POTASSIUM ION, Proteasome accessory factor B/C (PafBC), ... | Authors: | Mueller, A.U, Leibundgut, M, Ban, N, Weber-Ban, E. | Deposit date: | 2019-08-13 | Release date: | 2019-10-16 | Last modified: | 2019-10-23 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Structure and functional implications of WYL domain-containing bacterial DNA damage response regulator PafBC. Nat Commun, 10, 2019
|
|
4V1A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4v1a by Molmil](/molmil-images/mine/4v1a) | Structure of the large subunit of the mammalian mitoribosome, part 2 of 2 | Descriptor: | MITORIBOSOMAL PROTEIN ML37, MRPL37, MITORIBOSOMAL PROTEIN ML38, ... | Authors: | Greber, B.J, Boehringer, D, Leibundgut, M, Bieri, P, Leitner, A, Schmitz, N, Aebersold, R, Ban, N. | Deposit date: | 2014-09-25 | Release date: | 2014-10-08 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | The Complete Structure of the Large Subunit of the Mammalian Mitochondrial Ribosome Nature, 515, 2014
|
|
4V19
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4v19 by Molmil](/molmil-images/mine/4v19) | Structure of the large subunit of the mammalian mitoribosome, part 1 of 2 | Descriptor: | MAGNESIUM ION, MITORIBOSOMAL 16S RRNA, MITORIBOSOMAL CP TRNA, ... | Authors: | Greber, B.J, Boehringer, D, Leibundgut, M, Bieri, P, Leitner, A, Schmitz, N, Aebersold, R, Ban, N. | Deposit date: | 2014-09-25 | Release date: | 2014-10-08 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | The Complete Structure of the Large Subunit of the Mammalian Mitochondrial Ribosome Nature, 515, 2014
|
|
4V59
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4v59 by Molmil](/molmil-images/mine/4v59) | Crystal structure of fatty acid synthase complexed with nadp+ from thermomyces lanuginosus at 3.1 angstrom resolution. | Descriptor: | FATTY ACID SYNTHASE ALPHA SUBUNITS, FATTY ACID SYNTHASE BETA SUBUNITS, FLAVIN MONONUCLEOTIDE, ... | Authors: | Jenni, S, Leibundgut, M, Boehringer, D, Frick, C, Mikolasek, B, Ban, N. | Deposit date: | 2007-03-09 | Release date: | 2014-07-09 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Structure of Fungal Fatty Acid Synthase and Implications for Iterative Substrate Shuttling Science, 316, 2007
|
|
4V8T
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4v8t by Molmil](/molmil-images/mine/4v8t) | Cryo-EM Structure of the 60S Ribosomal Subunit in Complex with Arx1 and Rei1 | Descriptor: | 25S RIBOSOMAL RNA, 5.8S RIBOSOMAL RNA, 5S RIBOSOMAL RNA, ... | Authors: | Greber, B.J, Boehringer, D, Montellese, C, Ban, N. | Deposit date: | 2012-08-07 | Release date: | 2014-07-09 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (8.1 Å) | Cite: | Cryo-Em Structures of Arx1 and Maturation Factors Rei1 and Jjj1 Bound to the 60S Ribosomal Subunit Nat.Struct.Mol.Biol., 19, 2012
|
|
4V5B
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4v5b by Molmil](/molmil-images/mine/4v5b) | Structure of PDF binding helix in complex with the ribosome. | Descriptor: | 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, ... | Authors: | Bingel-Erlenmeyer, R, Kohler, R, Kramer, G, Sandikci, A, Antolic, S, Maier, T, Schaffitzel, C, Wiedmann, B, Bukau, B, Ban, N. | Deposit date: | 2007-11-22 | Release date: | 2014-07-09 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.74 Å) | Cite: | A Peptide Deformylase-Ribosome Complex Reveals Mechanism of Nascent Chain Processing. Nature, 452, 2008
|
|
4V8L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4v8l by Molmil](/molmil-images/mine/4v8l) | |
1K8A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1k8a by Molmil](/molmil-images/mine/1k8a) | Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T. | Deposit date: | 2001-10-23 | Release date: | 2002-07-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol.Cell, 10, 2002
|
|
4UER
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4uer by Molmil](/molmil-images/mine/4uer) | 40S-eIF1-eIF1A-eIF3-eIF3j translation initiation complex from Lachancea kluyveri | Descriptor: | 18S RRNA, EIF1, EIF1A, ... | Authors: | Aylett, C.H.S, Boehringer, D, Erzberger, J.P, Schaefer, T, Ban, N. | Deposit date: | 2014-12-18 | Release date: | 2015-02-11 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (6.47 Å) | Cite: | Structure of a Yeast 40S-Eif1-Eif1A-Eif3-Eif3J Initiation Complex Nat.Struct.Mol.Biol., 22, 2015
|
|
4V8P
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4v8p by Molmil](/molmil-images/mine/4v8p) | T.thermophila 60S ribosomal subunit in complex with initiation factor 6. | Descriptor: | 26S RRNA, 5.8S RRNA, 5S RRNA, ... | Authors: | Klinge, S, Voigts-Hoffmann, F, Leibundgut, M, Arpagaus, S, Ban, N. | Deposit date: | 2011-09-14 | Release date: | 2014-07-09 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.52 Å) | Cite: | Crystal Structure of the Eukaryotic 60S Ribosomal Subunit in Complex with Initiation Factor 6. Science, 334, 2011
|
|
4V5O
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4v5o by Molmil](/molmil-images/mine/4v5o) | CRYSTAL STRUCTURE OF THE EUKARYOTIC 40S RIBOSOMAL SUBUNIT IN COMPLEX WITH INITIATION FACTOR 1. | Descriptor: | 18S RRNA, 40S RIBOSOMAL PROTEIN S12, 40S RIBOSOMAL PROTEIN S3A, ... | Authors: | Rabl, J, Leibundgut, M, Ataide, S.F, Haag, A, Ban, N. | Deposit date: | 2010-11-26 | Release date: | 2014-07-09 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.93 Å) | Cite: | Crystal Structure of the Eukaryotic 40S Ribosomal Subunit in Complex with Initiation Factor 1. Science, 331, 2011
|
|
4V58
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4v58 by Molmil](/molmil-images/mine/4v58) | Crystal structure of fatty acid synthase from thermomyces lanuginosus at 3.1 angstrom resolution. | Descriptor: | FATTY ACID SYNTHASE ALPHA SUBUNITS, FATTY ACID SYNTHASE BETA SUBUNITS, FLAVIN MONONUCLEOTIDE | Authors: | Jenni, S, Leibundgut, M, Boehringer, D, Frick, C, Mikolasek, B, Ban, N. | Deposit date: | 2007-03-09 | Release date: | 2014-07-09 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Structure of Fungal Fatty Acid Synthase and Implications for Iterative Substrate Shuttling Science, 316, 2007
|
|
3MF1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3mf1 by Molmil](/molmil-images/mine/3mf1) | Crystal structure of class II aaRS homologue (Bll0957) complexed with an analogue of glycyl adenylate | Descriptor: | 5'-O-(glycylsulfamoyl)adenosine, Bll0957 protein, ZINC ION | Authors: | Weygand-Durasevic, I, Mocibob, M, Ivic, N, Bilokapic, S, Maier, T, Luic, M, Ban, N. | Deposit date: | 2010-04-01 | Release date: | 2010-07-28 | Last modified: | 2017-11-08 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Homologs of aminoacyl-tRNA synthetases acylate carrier proteins and provide a link between ribosomal and nonribosomal peptide synthesis Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
5LFQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5lfq by Molmil](/molmil-images/mine/5lfq) | Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis (space group P3) | Descriptor: | Bacterial proteasome activator | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | Deposit date: | 2016-07-04 | Release date: | 2016-11-23 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.503 Å) | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome. Structure, 24, 2016
|
|
5LFJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5lfj by Molmil](/molmil-images/mine/5lfj) | Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis | Descriptor: | Bacterial proteasome activator | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | Deposit date: | 2016-07-01 | Release date: | 2016-11-23 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome. Structure, 24, 2016
|
|
4B0S
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4b0s by Molmil](/molmil-images/mine/4b0s) | Structure of the Deamidase-Depupylase Dop of the Prokaryotic Ubiquitin-like Modification Pathway in Complex with ATP | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, DEAMIDASE-DEPUPYLASE DOP, MAGNESIUM ION | Authors: | Ozcelik, D, Barandun, J, Schmitz, N, Sutter, M, Guth, E, Damberger, F.F, Allain, F.H.-T, Ban, N, Weber-Ban, E. | Deposit date: | 2012-07-04 | Release date: | 2012-09-12 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.85 Å) | Cite: | Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway. Nat.Commun., 3, 2012
|
|
5APO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5apo by Molmil](/molmil-images/mine/5apo) | Structure of the yeast 60S ribosomal subunit in complex with Arx1, Alb1 and C-terminally tagged Rei1 | Descriptor: | 25S ribosomal RNA, 5.8S ribosomal RNA, 5S ribosomal RNA, ... | Authors: | Greber, B.J, Gerhardy, S, Leitner, A, Leibundgut, M, Salem, M, Boehringer, D, Leulliot, N, Aebersold, R, Panse, V.G, Ban, N. | Deposit date: | 2015-09-17 | Release date: | 2015-12-16 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.41 Å) | Cite: | Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation. Cell(Cambridge,Mass.), 164, 2016
|
|
5LRT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5lrt by Molmil](/molmil-images/mine/5lrt) | Structure of the Deamidase-Depupylase Dop of the Prokaryotic Ubiquitin-like Modification Pathway in Complex with ADP and Phosphate | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, DI(HYDROXYETHYL)ETHER, Depupylase, ... | Authors: | Bolten, M, Vahlensieck, C, Lipp, C, Leibundgut, M, Ban, N, Weber-Ban, E. | Deposit date: | 2016-08-19 | Release date: | 2017-02-01 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (1.85 Å) | Cite: | Depupylase Dop Requires Inorganic Phosphate in the Active Site for Catalysis. J. Biol. Chem., 292, 2017
|
|
5LFP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5lfp by Molmil](/molmil-images/mine/5lfp) | Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis (space group P6322, SeMet) | Descriptor: | Bacterial proteasome activator | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | Deposit date: | 2016-07-04 | Release date: | 2016-11-23 | Last modified: | 2016-12-14 | Method: | X-RAY DIFFRACTION (3.303 Å) | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome. Structure, 24, 2016
|
|