5E3N
Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)
Summary for 5E3N
Entry DOI | 10.2210/pdb5e3n/pdb |
Related | 5DS9 5DTD 5E3L 5E3M 5E3O |
Descriptor | DNA-binding protein Fis, DNA (27-MER), ... (4 entities in total) |
Functional Keywords | protein-dna complex, hth domain, dna bending, indirect recognition, dna binding protein-dna complex, dna binding protein/dna |
Biological source | Escherichia coli More |
Total number of polymer chains | 4 |
Total formula weight | 39091.64 |
Authors | Hancock, S.P.,Cascio, D.,Johnson, R.C. (deposition date: 2015-10-03, release date: 2016-03-09, Last modification date: 2022-03-23) |
Primary citation | Hancock, S.P.,Stella, S.,Cascio, D.,Johnson, R.C. DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11:e0150189-e0150189, 2016 Cited by PubMed: 26959646DOI: 10.1371/journal.pone.0150189 PDB entries with the same primary citation |
Experimental method | X-RAY DIFFRACTION (2.66 Å) |
Structure validation
Download full validation report