5E3N
Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)
Entity
Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
1 | A, B (A, B) | DNA-binding protein Fis | polymer | 98 | 11252.9 | 2 | UniProt (P0A6R3) Pfam (PF02954) | Escherichia coli | Factor-for-inversion stimulation protein,Hin recombinational enhancer-binding protein |
2 | C (C) | DNA (27-MER) | polymer | 27 | 8319.4 | 1 | synthetic construct | ||
3 | D (D) | DNA (27-MER) | polymer | 27 | 8266.4 | 1 | synthetic construct | ||
4 | E, F, G (A, B, C) | water | water | 18.0 | 9 | Chemie (HOH) |
Sequence viewer
Contents of the asymmetric unit
Polymers | Number of chains | 4 |
Total formula weight | 39091.6 | |
All* | Total formula weight | 39091.6 |