Loading
PDBj
MenuPDBj@FacebookPDBj@X(formerly Twitter)PDBj@BlueSkyPDBj@YouTubewwPDB FoundationwwPDBDonate
RCSB PDBPDBeBMRBAdv. SearchSearch help

5BTG

Crystal structure of a topoisomerase II complex

Entity
Entity IDChain IDDescriptionTypeChain lengthFormula weightNumber of moleculesDB Name (Accession)Biological sourceDescriptive keywords
1A, C
(A, C)
DNA gyrase subunit Apolymer50356209.42UniProt (P9WG47)
Pfam (PF00521)
Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
2B, D
(B, D)
DNA gyrase subunit Bpolymer25328272.42UniProt (P9WG45)
Pfam (PF01751)
Pfam (PF00986)
Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
3E, H
(E, H)
DNA substrate 24-mer GGTCATGAATGACTATGCACGTAApolymer247417.82synthetic construct
4F, G
(F, G)
DNA substrate 24-mer TTACGTGCATAGTCATTCATGACCpolymer247319.72synthetic construct
5I, J, L, N
(B, D, E, F)
MAGNESIUM IONnon-polymer24.34Chemie (MG)
6K, M
(E, F)
(3S)-9-fluoro-3-methyl-10-(4-methylpiperazin-1-yl)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acidnon-polymer361.42Chemie (LFX)
7O, P, Q, R, S...
(A, B, C, D, E...)
waterwater18.0189Chemie (HOH)
Sequence modifications
A, C: 2 - 500 (UniProt: P9WG47)
PDBExternal DatabaseDetails
Ile 501-expression tag
Gly 502-expression tag
Ser 503-expression tag
Gly 504-expression tag
B, D: 426 - 675 (UniProt: P9WG45)
PDBExternal DatabaseDetails
Ser 423-expression tag
Asn 424-expression tag
Ala 425-expression tag
Sequence viewer
Contents of the asymmetric unit
PolymersNumber of chains8
Total formula weight198438.8
Non-Polymers*Number of molecules6
Total formula weight820.0
All*Total formula weight199258.7
*Water molecules are not included.

247536

PDB entries from 2026-01-14

PDB statisticsPDBj update infoContact PDBjnumon