5BTD
Crystal structure of a topoisomerase II complex
Entity
Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
1 | A, C (A, C) | DNA gyrase subunit A | polymer | 503 | 56209.4 | 2 | UniProt (P9WG47) Pfam (PF00521) | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) | |
2 | B, D (B, D) | DNA gyrase subunit B | polymer | 253 | 28272.4 | 2 | UniProt (P9WG45) Pfam (PF01751) Pfam (PF00986) | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) | |
3 | E, H (E, H) | DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA | polymer | 24 | 7417.8 | 2 | synthetic construct | ||
4 | F, G (F, G) | DNA substrate 24-mer TTACGTGCATAGTCATTCATGACC | polymer | 24 | 7319.7 | 2 | synthetic construct | ||
5 | I, J, L, M (B, D, E, F) | MAGNESIUM ION | non-polymer | 24.3 | 4 | Chemie (MG) | |||
6 | K, N (E, G) | 1-cyclopropyl-6-fluoro-8-methoxy-7-[(3S)-3-methylpiperazin-1-yl]-4-oxo-1,4-dihydroquinoline-3-carboxylic acid | non-polymer | 375.4 | 2 | Chemie (GFN) | |||
7 | O, P, Q, R, S... (A, B, C, D, E...) | water | water | 18.0 | 211 | Chemie (HOH) |
Sequence modifications
A, C: 2 - 500 (UniProt: P9WG47)
B, D: 426 - 675 (UniProt: P9WG45)
PDB | External Database | Details |
---|---|---|
Ile 501 | - | expression tag |
Gly 502 | - | expression tag |
Ser 503 | - | expression tag |
Gly 504 | - | expression tag |
PDB | External Database | Details |
---|---|---|
Ser 423 | - | expression tag |
Asn 424 | - | expression tag |
Ala 425 | - | expression tag |
Sequence viewer
Contents of the asymmetric unit
Polymers | Number of chains | 8 |
Total formula weight | 198438.8 | |
Non-Polymers* | Number of molecules | 6 |
Total formula weight | 848.0 | |
All* | Total formula weight | 199286.8 |