5BTD

Crystal structure of a topoisomerase II complex

Entity

Entity ID	Chain ID	Description	Type	Chain length	Formula weight	Number of molecules	DB Name (Accession)	Biological source	Descriptive keywords
1	A, C	DNA gyrase subunit A	polymer	503	56209.4	2	UniProt (P9WG47) Pfam (PF00521) In PDB	Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
2	B, D	DNA gyrase subunit B	polymer	253	28272.4	2	UniProt (P9WG45) Pfam (PF01751) Pfam (PF00986) In PDB	Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
3	E, H	DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA	polymer	24	7417.8	2		synthetic construct
4	F, G	DNA substrate 24-mer TTACGTGCATAGTCATTCATGACC	polymer	24	7319.7	2		synthetic construct
5	B, D, E, F	MAGNESIUM ION	non-polymer		24.3	4	Chemie (MG)
6	E, G	1-cyclopropyl-6-fluoro-8-methoxy-7-[(3S)-3-methylpiperazin-1-yl]-4-oxo-1,4-dihydroquinoline-3-carboxylic acid	non-polymer		375.4	2	Chemie (GFN)
7		water	water		18.0	211	Chemie (HOH)

Sequence modifications

A, C: 2 - 500 (UniProt: P9WG47)

PDB	External Database	Details
Ile 501	-	expression tag
Gly 502	-	expression tag
Ser 503	-	expression tag
Gly 504	-	expression tag

B, D: 426 - 675 (UniProt: P9WG45)

PDB	External Database	Details
Ser 423	-	expression tag
Asn 424	-	expression tag
Ala 425	-	expression tag

Contents of the asymmetric unit

Polymers	Number of chains	8
	Total formula weight	198438.8
Non-Polymers*	Number of molecules	6
	Total formula weight	848.0
All*	Total formula weight	199286.8

*Water molecules are not included.