Author results

107D
  • Download 107d
  • View 107d
Molmil generated image of 107d
SOLUTION STRUCTURE OF THE COVALENT DUOCARMYCIN A-DNA DUPLEX COMPLEX
Descriptor:DNA (5'-D(*CP*CP*TP*TP*TP*TP*C)-3'), DNA (5'-D(*GP*AP*AP*AP*AP*GP*G)-3'), 4-HYDROXY-2,8-DIMETHYL-1-OXO-6-(4,5,6-TRIMETHOXY-1H-INDOLE-2-CARBONYL)-1,2,3,6,7,8-HEXAHYDRO-3,6-DIAZA-AS-INDACENE-2-CARBOXYLIC ACID METHYL ESTER
Authors:Lin, C.H., Patel, D.J.
Deposit date:1995-01-17
Release date:1995-05-08
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the covalent duocarmycin A-DNA duplex complex.
J.Mol.Biol., 248, 1995
1AW4
  • Download 1aw4
  • View 1aw4
Molmil generated image of 1aw4
STRUCTURAL BASIS OF DNA FOLDING AND RECOGNITION IN AMP-DNA APTAMER COMPLEX, NMR, 7 STRUCTURES
Descriptor:ATP-BINDING DNA APTAMER, ADENOSINE MONOPHOSPHATE
Authors:Lin, C.H., Patel, D.J.
Deposit date:1997-10-09
Release date:1998-04-15
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Structural basis of DNA folding and recognition in an AMP-DNA aptamer complex: distinct architectures but common recognition motifs for DNA and RNA aptamers complexed to AMP.
Chem.Biol., 4, 1997
1JJS
  • Download 1jjs
  • View 1jjs
Molmil generated image of 1jjs
NMR STRUCTURE OF IBID, A DOMAIN OF CBP/P300
Descriptor:CREB-BINDING PROTEIN
Authors:Lin, C.H., Hare, B.J., Wagner, G., Harrison, S.C., Maniatis, T., Fraenkel, E.
Deposit date:2001-07-09
Release date:2001-10-03
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:A small domain of CBP/p300 binds diverse proteins: solution structure and functional studies.
Mol.Cell, 8, 2001
1OLD
  • Download 1old
  • View 1old
Molmil generated image of 1old
NMR STRUCTURE OF 24-MER DEOXYRIBONUCLEIC ACID, 7 STRUCTURES
Descriptor:DNA (GATCGAAACGTAGCGCCTTCGATC), DEOXY-METHYL-ARGININE
Authors:Lin, C.H., Patel, D.J.
Deposit date:1996-10-31
Release date:1997-04-21
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Encapsulating an amino acid in a DNA fold.
Nat.Struct.Biol., 3, 1996
2ARG
  • Download 2arg
  • View 2arg
Molmil generated image of 2arg
FORMATION OF AN AMINO ACID BINDING POCKET THROUGH ADAPTIVE ZIPPERING-UP OF A LARGE DNA HAIRPIN LOOP, NMR, 9 STRUCTURES
Descriptor:DNA APTAMER [5'-D (*TP*GP*AP*CP*CP*AP*GP*GP*GP*CP*AP*AP*AP*CP*GP*GP*TP*AP* GP*GP*TP*GP*AP*GP*TP*GP*GP*TP*CP*A)-3'], DEOXY-METHYL-ARGININE
Authors:Lin, C.H., Wang, W., Jones, R.A., Patel, D.J.
Deposit date:1998-08-19
Release date:1999-03-23
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Formation of an amino-acid-binding pocket through adaptive zippering-up of a large DNA hairpin loop.
Chem.Biol., 5, 1998
1HWV
  • Download 1hwv
  • View 1hwv
Molmil generated image of 1hwv
MOLECULAR TOPOLOGY OF POLYCYCLIC AROMATIC CARCINOGENS DETERMINES DNA ADDUCT CONFORMATION: A LINK TO TUMORIGENIC ACTIVITY
Descriptor:5'-D(*CP*CP*AP*TP*CP*GP*CP*TP*AP*CP*C)-3', 5'-D(*GP*GP*TP*AP*GP*CP*GP*AP*TP*GP*G)-3', (1S)-1,2,3,4-TETRAHYDRO-BENZO[C]PHENANTHRENE-2,3,4-TRIOL
Authors:Patel, D.J., Lin, C.H., Geacintov, N.E., Broyde, S., Huang, X., Kolbanovskii, A., Hingerty, B.E., Amin, S.
Deposit date:2001-01-10
Release date:2001-03-21
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Molecular topology of polycyclic aromatic carcinogens determines DNA adduct conformation: a link to tumorigenic activity.
J.Mol.Biol., 306, 2001
1HX4
  • Download 1hx4
  • View 1hx4
Molmil generated image of 1hx4
MOLECULAR TOPOLOGY OF POLYCYCLIC AROMATIC CARCINOGENS DETERMINES DNA ADDUCT CONFORMATION: A LINK TO TUMORIGENIC ACTIVITY
Descriptor:5'-D(*CP*CP*AP*TP*CP*GP*CP*TP*AP*CP*C)-3', 5'-D(*GP*GP*TP*AP*GP*CP*GP*AP*TP*GP*G)-3', (1R)-1,2,3,4-TETRAHYDRO-BENZO[C]PHENANTHRENE-2,3,4-TRIOL
Authors:Patel, D.J., Lin, C.H., Geacintov, N.E., Broyde, S., Huang, X., Kolbanovskii, A., Hingerty, B.E., Amin, S.
Deposit date:2001-01-11
Release date:2001-03-21
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Molecular topology of polycyclic aromatic carcinogens determines DNA adduct conformation: a link to tumorigenic activity.
J.Mol.Biol., 306, 2001
4Y24
  • Download 4y24
  • View 4y24
Molmil generated image of 4y24
COMPLEX OF HUMAN GALECTIN-1 AND TD-139
Descriptor:Galectin-1, 3-deoxy-3-[4-(3-fluorophenyl)-1H-1,2,3-triazol-1-yl]-beta-D-galactopyranosyl 3-deoxy-3-[4-(3-fluorophenyl)-1H-1,2,3-triazol-1-yl]-1-thio-beta-D-galactopyranoside
Authors:Lin, H.Y., Hsieh, T.J., Lin, C.H.
Deposit date:2015-02-09
Release date:2016-04-27
Last modified:2016-08-03
Method:X-RAY DIFFRACTION (2.32 Å)
Cite:Dual thio-digalactoside-binding modes of human galectins as the structural basis for the design of potent and selective inhibitors.
Sci Rep, 6, 2016
5H9P
  • Download 5h9p
  • View 5h9p
Molmil generated image of 5h9p
CRYSTAL STRUCTURE OF HUMAN GALECTIN-3 CRD IN COMPLEX WITH TD139
Descriptor:Galectin-3, 3-deoxy-3-[4-(3-fluorophenyl)-1H-1,2,3-triazol-1-yl]-beta-D-galactopyranosyl 3-deoxy-3-[4-(3-fluorophenyl)-1H-1,2,3-triazol-1-yl]-1-thio-beta-D-galactopyranoside
Authors:Hsieh, T.J., Lin, H.Y., Lin, C.H.
Deposit date:2015-12-29
Release date:2016-06-29
Last modified:2016-07-27
Method:X-RAY DIFFRACTION (2.04 Å)
Cite:Dual thio-digalactoside-binding modes of human galectins as the structural basis for the design of potent and selective inhibitors
Sci Rep, 6, 2016
5H9Q
  • Download 5h9q
  • View 5h9q
Molmil generated image of 5h9q
CRYSTAL STRUCTURE OF HUMAN GALECTIN-7 IN COMPLEX WITH TD139
Descriptor:Galectin-7, 3-deoxy-3-[4-(3-fluorophenyl)-1H-1,2,3-triazol-1-yl]-beta-D-galactopyranosyl 3-deoxy-3-[4-(3-fluorophenyl)-1H-1,2,3-triazol-1-yl]-1-thio-beta-D-galactopyranoside
Authors:Hsieh, T.J., Lin, H.Y., Lin, C.H.
Deposit date:2015-12-29
Release date:2016-06-29
Last modified:2016-07-27
Method:X-RAY DIFFRACTION (1.931 Å)
Cite:Dual thio-digalactoside-binding modes of human galectins as the structural basis for the design of potent and selective inhibitors
Sci Rep, 6, 2016
5H9R
  • Download 5h9r
  • View 5h9r
Molmil generated image of 5h9r
CRYSTAL STRUCTURE OF HUMAN GALECTIN-3 CRD IN COMPLEX WITH TAZTDG
Descriptor:Galectin-3, (2~{S},3~{R},4~{S},5~{R},6~{R})-2-[(2~{S},3~{R},4~{S},5~{R},6~{R})-4-[4-(3-fluorophenyl)-1,2,3-triazol-1-yl]-6-(hydroxymethyl)-3,5-bis(oxidanyl)oxan-2-yl]sulfanyl-6-(hydroxymethyl)oxane-3,4,5-triol
Authors:Hsieh, T.J., Lin, H.Y., Lin, C.H.
Deposit date:2015-12-29
Release date:2016-06-29
Last modified:2016-07-27
Method:X-RAY DIFFRACTION (1.58 Å)
Cite:Dual thio-digalactoside-binding modes of human galectins as the structural basis for the design of potent and selective inhibitors
Sci Rep, 6, 2016
5H9S
  • Download 5h9s
  • View 5h9s
Molmil generated image of 5h9s
CRYSTAL STRUCTURE OF HUMAN GALECTIN-7 IN COMPLEX WITH TAZTDG
Descriptor:Galectin-7, (2~{S},3~{R},4~{S},5~{R},6~{R})-2-[(2~{S},3~{R},4~{S},5~{R},6~{R})-4-[4-(3-fluorophenyl)-1,2,3-triazol-1-yl]-6-(hydroxymethyl)-3,5-bis(oxidanyl)oxan-2-yl]sulfanyl-6-(hydroxymethyl)oxane-3,4,5-triol
Authors:Hsieh, T.J., Lin, H.Y., Lin, C.H.
Deposit date:2015-12-29
Release date:2016-06-29
Last modified:2016-07-27
Method:X-RAY DIFFRACTION (1.821 Å)
Cite:Dual thio-digalactoside-binding modes of human galectins as the structural basis for the design of potent and selective inhibitors
Sci Rep, 6, 2016
5Z18
  • Download 5z18
  • View 5z18
Molmil generated image of 5z18
THE CRYSTAL STRUCTURE OF RUMINOCOCCUS GNAVUS BETA-GLUCURONIDASE
Descriptor:Beta-glucuronidase
Authors:Dashnyam, P., Lin, H.Y., Lin, C.H.
Deposit date:2017-12-25
Release date:2018-12-12
Method:X-RAY DIFFRACTION (2.495 Å)
Cite:Dissection of the substrate preference and structure of gut microbial beta-glucuronidases identifies the major bacteria causing xenobiotic toxicity
To Be Published
5Z19
  • Download 5z19
  • View 5z19
Molmil generated image of 5z19
THE CRYSTAL STRUCTURE OF RUMINOCOCCUS GNAVUS BETA-GLUCURONIDASE IN COMPLEX WITH URONIC ISOFAGOMINE
Descriptor:Beta-glucuronidase, (3S,4R,5R)-4,5-dihydroxypiperidine-3-carboxylic acid
Authors:Dashnyam, P., Lin, H.Y., Lin, C.H.
Deposit date:2017-12-25
Release date:2018-12-12
Method:X-RAY DIFFRACTION (2.503 Å)
Cite:Dissection of the substrate preference and structure of gut microbial beta-glucuronidases identifies the major bacteria causing xenobiotic toxicity
To Be Published
5Z1A
  • Download 5z1a
  • View 5z1a
Molmil generated image of 5z1a
THE CRYSTAL STRUCTURE OF BACTEROIDES FRAGILIS BETA-GLUCURONIDASE IN COMPLEX WITH URONIC ISOFAGOMINE
Descriptor:Putative beta-galactosidase, (3S,4R,5R)-4,5-dihydroxypiperidine-3-carboxylic acid
Authors:Dashnyam, P., Lin, H.Y., Lin, C.H.
Deposit date:2017-12-25
Release date:2018-12-12
Method:X-RAY DIFFRACTION (1.859 Å)
Cite:Dissection of the substrate preference and structure of gut microbial-glucuronidases identifies the major bacteria causing xenobiotic toxicity
To Be Published
5Z1B
  • Download 5z1b
  • View 5z1b
Molmil generated image of 5z1b
STRUCTURE OF BIFIDOBACTERIUM DENTIUM BETA-GLUCURONIDASE COMPLEXED WITH COUMARIN-3-O-GLUCURONIDE
Descriptor:Glycosyl hydrolase family 2, TIM barrel domain protein, BETA-D-GLUCOPYRANURONIC ACID, ...
Authors:Dashnyam, P., Lin, H.Y., Lin, C.H.
Deposit date:2017-12-25
Release date:2018-12-12
Method:X-RAY DIFFRACTION (1.45 Å)
Cite:Dissection of the substrate preference and structure of gut microbial-glucuronidases identifies the major bacteria causing xenobiotic toxicity
To Be Published
3PHJ
  • Download 3phj
  • View 3phj
Molmil generated image of 3phj
SHIKIMATE 5-DEHYDROGENASE (AROE) FROM HELICOBACTER PYLORI IN COMPLEX WITH 3-DEHYDROSHIKIMATE
Descriptor:Shikimate dehydrogenase, 3-DEHYDROSHIKIMATE
Authors:Cheng, W.C., Lin, S.C., Lin, C.H., Wang, W.C.
Deposit date:2010-11-04
Release date:2011-11-09
Method:X-RAY DIFFRACTION (2.3 Å)
Cite:Shikimate 5-Dehydrogenase (aroE) from Helicobacter pylori in complex with 3-Dehydroshikimate
To be Published
4XBL
  • Download 4xbl
  • View 4xbl
Molmil generated image of 4xbl
CRYSTAL STRUCTURE OF HUMAN GALECTIN-1 IN COMPLEX WITH TYPE 1 N-ACETYLLACTOSAMINE
Descriptor:Galectin-1, BETA-D-GALACTOSE, N-ACETYL-D-GLUCOSAMINE
Authors:Hsieh, T.J., Lin, H.Y., Lin, C.H.
Deposit date:2014-12-17
Release date:2015-05-20
Method:X-RAY DIFFRACTION (1.931 Å)
Cite:Structural Basis Underlying the Binding Preference of Human Galectins-1, -3 and -7 for Gal beta 1-3/4GlcNAc.
Plos One, 10, 2015
4XBN
  • Download 4xbn
  • View 4xbn
Molmil generated image of 4xbn
CRYSTAL STRUCTURE OF HUMAN GALECTIN-3 CRD IN COMPLEX WITH TYPE 1 N-ACETYLLACTOSAMINE
Descriptor:Galectin-3, BETA-D-GALACTOSE, N-ACETYL-D-GLUCOSAMINE
Authors:Hsieh, T.J., Lin, H.Y., Lin, C.H.
Deposit date:2014-12-17
Release date:2015-05-20
Method:X-RAY DIFFRACTION (2.208 Å)
Cite:Structural Basis Underlying the Binding Preference of Human Galectins-1, -3 and -7 for Gal beta 1-3/4GlcNAc.
Plos One, 10, 2015
4XBQ
  • Download 4xbq
  • View 4xbq
Molmil generated image of 4xbq
CRYSTAL STRUCTURE OF HUMAN GALECTIN-7 IN COMPLEX WITH TYPE 1 N-ACETYLLACTOSAMINE
Descriptor:Galectin-7, BETA-D-GALACTOSE, N-ACETYL-D-GLUCOSAMINE
Authors:Hsieh, T.J., Lin, H.Y., Lin, C.H.
Deposit date:2014-12-17
Release date:2015-05-20
Method:X-RAY DIFFRACTION (2.234 Å)
Cite:Structural Basis Underlying the Binding Preference of Human Galectins-1, -3 and -7 for Gal beta 1-3/4GlcNAc.
Plos One, 10, 2015
4Y1U
  • Download 4y1u
  • View 4y1u
Molmil generated image of 4y1u
COMPLEX OF HUMAN GALECTIN-1 AND GALBETA1-4GLCNAC
Descriptor:Galectin-1, BETA-D-GALACTOSE, BETA-METHYL-N-ACETYL-D-GLUCOSAMINE
Authors:Lin, H.Y., Hsieh, T.J., Lin, C.H.
Deposit date:2015-02-09
Release date:2016-04-06
Method:X-RAY DIFFRACTION (1.762 Å)
Cite:Structural basis of human galectin-1 inhibition with Ki values in the micro- to nanomolar range
To Be Published
4Y1V
  • Download 4y1v
  • View 4y1v
Molmil generated image of 4y1v
COMPLEX OF HUMAN GALECTIN-1 AND GALBETA1-3GLCNAC
Descriptor:Galectin-1, BETA-METHYL-N-ACETYL-D-GLUCOSAMINE, BETA-D-GALACTOSE
Authors:Lin, H.Y., Hsieh, T.J., Lin, C.H.
Deposit date:2015-02-09
Release date:2016-04-06
Method:X-RAY DIFFRACTION (2.32 Å)
Cite:Structural basis of human galectin-1 inhibition with Ki values in the micro- to nanomolar range
To Be Published
4Y1X
  • Download 4y1x
  • View 4y1x
Molmil generated image of 4y1x
COMPLEX OF HUMAN GALECTIN-1 AND GALBETA1-4(6OSO3)GLCNAC
Descriptor:Galectin-1, BETA-D-GALACTOSE, methyl 2-(acetylamino)-2-deoxy-6-O-sulfo-beta-D-glucopyranoside
Authors:Lin, H.Y., Hsieh, T.J., Lin, C.H.
Deposit date:2015-02-09
Release date:2016-04-06
Method:X-RAY DIFFRACTION (2.45 Å)
Cite:Structural basis of human galectin-1 inhibition with Ki values in the micro- to nanomolar range
To Be Published
4Y1Y
  • Download 4y1y
  • View 4y1y
Molmil generated image of 4y1y
COMPLEX OF HUMAN GALECTIN-1 AND (6OSO3)GALBETA1-3GLCNAC
Descriptor:Galectin-1, BETA-D-GALACTOSE, methyl 2-(acetylamino)-2-deoxy-6-O-sulfo-beta-D-glucopyranoside
Authors:Lin, H.Y., Hsieh, T.J., Lin, C.H.
Deposit date:2015-02-09
Release date:2016-04-06
Method:X-RAY DIFFRACTION (1.86 Å)
Cite:Structural basis of human galectin-1 inhibition with Ki values in the micro- to nanomolar range
To Be Published
4Y1Z
  • Download 4y1z
  • View 4y1z
Molmil generated image of 4y1z
COMPLEX OF HUMAN GALECTIN-1 AND GALBETA1-4(6CO2)GLCNAC
Descriptor:Galectin-1, BETA-D-GALACTOSE, methyl 2-(acetylamino)-2-deoxy-beta-D-glucopyranosiduronic acid
Authors:Lin, H.Y., Hsieh, T.J., Lin, C.H.
Deposit date:2015-02-09
Release date:2016-04-06
Method:X-RAY DIFFRACTION (2.23 Å)
Cite:Structural basis of human galectin-1 inhibition with Ki values in the micro- to nanomolar range
To Be Published
<123>