Author results

1ARO
  • Download 1aro
  • View 1aro
Molmil generated image of 1aro
T7 RNA POLYMERASE COMPLEXED WITH T7 LYSOZYME
Descriptor:T7 RNA POLYMERASE, T7 LYSOZYME, MERCURY (II) ION
Authors:Steitz, T., Jeruzalmi, D.
Deposit date:1997-08-08
Release date:1998-10-21
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.8 Å)
Cite:Structure of T7 RNA polymerase complexed to the transcriptional inhibitor T7 lysozyme.
EMBO J., 17, 1998
1B77
  • Download 1b77
  • View 1b77
Molmil generated image of 1b77
BUILDING A REPLISOME STRUCTURE FROM INTERACTING PIECES: A SLIDING CLAMP COMPLEXED WITH AN INTERACTION PEPTIDE FROM DNA POLYMERASE
Descriptor:PROTEIN (SLIDING CLAMP)
Authors:Shamoo, Y., Steitz, T.A.
Deposit date:1999-01-27
Release date:1999-02-08
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.1 Å)
Cite:Building a replisome from interacting pieces: sliding clamp complexed to a peptide from DNA polymerase and a polymerase editing complex.
Cell(Cambridge,Mass.), 99, 1999
1B8H
  • Download 1b8h
  • View 1b8h
Molmil generated image of 1b8h
SLIDING CLAMP, DNA POLYMERASE
Descriptor:DNA POLYMERASE PROCESSIVITY COMPONENT, DNA POLYMERASE fragment
Authors:Shamoo, Y., Steitz, T.A.
Deposit date:1999-02-01
Release date:1999-02-09
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:Building a replisome from interacting pieces: sliding clamp complexed to a peptide from DNA polymerase and a polymerase editing complex.
Cell(Cambridge,Mass.), 99, 1999
1BDN
  • Download 1bdn
  • View 1bdn
Molmil generated image of 1bdn
CRYSTAL LATTICE PACKING IS IMPORTANT IN DETERMINING THE BEND OF A DNA DODECAMER CONTAINING AN ADENINE TRACT
Descriptor:DNA (5'-D(*CP*GP*CP*AP*AP*AP*AP*AP*TP*GP*CP*G)-3'), DNA (5'-D(*CP*GP*CP*AP*TP*TP*TP*TP*TP*GP*CP*G)-3'), MAGNESIUM ION
Authors:DiGabriele, A.D., Sanderson, M.R., Steitz, T.A.
Deposit date:1989-07-25
Release date:1991-04-15
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.6 Å)
Cite:Crystal lattice packing is important in determining the bend of a DNA dodecamer containing an adenine tract.
Proc.Natl.Acad.Sci.USA, 86, 1989
1C04
  • Download 1c04
  • View 1c04
Molmil generated image of 1c04
IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI
Descriptor:23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L6, ...
Authors:Ban, N., Nissen, P., Capel, M., Moore, P.B., Steitz, T.A.
Deposit date:1999-07-14
Release date:1999-08-31
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (5 Å)
Cite:Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit.
Nature, 400, 1999
1CEZ
  • Download 1cez
  • View 1cez
Molmil generated image of 1cez
CRYSTAL STRUCTURE OF A T7 RNA POLYMERASE-T7 PROMOTER COMPLEX
Descriptor:DNA (5'-D(P*TP*AP*TP*AP*GP*TP*GP*AP*GP*TP*CP*GP*TP*AP*TP*TP*A)-3'), DNA (5'-D(P*TP*AP*AP*TP*AP*CP*GP*AP*CP*TP*CP*AP*CP*TP*A)-3'), PROTEIN (BACTERIOPHAGE T7 RNA POLYMERASE)
Authors:Cheetham, G.M.T., Jeruzalmi, D., Steitz, T.A.
Deposit date:1999-03-11
Release date:1999-05-21
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:Structural basis for initiation of transcription from an RNA polymerase-promoter complex.
Nature, 399, 1999
1CGP
  • Download 1cgp
  • View 1cgp
Molmil generated image of 1cgp
CATABOLITE GENE ACTIVATOR PROTEIN (CAP)/DNA COMPLEX + ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE
Descriptor:DNA (5'-D(*GP*CP*GP*AP*AP*AP*AP*GP*TP*GP*TP*GP*AP*CP*AP*TP*AP*T)-3'), DNA (5'-D(*GP*TP*CP*AP*CP*AP*CP*TP*TP*TP*TP*CP*G)-3'), PROTEIN (CATABOLITE GENE ACTIVATOR PROTEIN (CAP)), ...
Authors:Schultz, S.C., Shields, G.C., Steitz, T.A.
Deposit date:1991-08-12
Release date:1994-01-31
Last modified:2017-02-15
Method:X-RAY DIFFRACTION (3 Å)
Cite:Crystal structure of a CAP-DNA complex: the DNA is bent by 90 degrees.
Science, 253, 1991
1CLQ
  • Download 1clq
  • View 1clq
Molmil generated image of 1clq
CRYSTAL STRUCTURE OF A REPLICATION FORK DNA POLYMERASE EDITING COMPLEX AT 2.7 A RESOLUTION
Descriptor:DNA (5'-D(*GP*CP*GP*GP*AP*AP*CP*TP*AP*CP*T)-3'), DNA (5'-D(*AP*GP*TP*AP*GP*TP*TP*CP*CP*GP*CP*G)-3'), PROTEIN (DNA POLYMERASE), ...
Authors:Shamoo, Y., Steitz, T.A.
Deposit date:1999-04-30
Release date:1999-10-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Building a replisome from interacting pieces: sliding clamp complexed to a peptide from DNA polymerase and a polymerase editing complex.
Cell(Cambridge,Mass.), 99, 1999
1CSL
  • Download 1csl
  • View 1csl
Molmil generated image of 1csl
CRYSTAL STRUCTURE OF THE RRE HIGH AFFINITY SITE
Descriptor:5'-R(*AP*AP*CP*GP*GP*GP*CP*GP*CP*AP*GP*AP*A)-3', 5'-R(*UP*CP*UP*GP*AP*CP*GP*GP*UP*AP*CP*GP*UP*UP*U)-3'
Authors:Ippolito, J.A., Steitz, T.A.
Deposit date:1999-08-18
Release date:2000-02-14
Last modified:2011-12-28
Method:X-RAY DIFFRACTION (1.6 Å)
Cite:The structure of the HIV-1 RRE high affinity rev binding site at 1.6 A resolution.
J.Mol.Biol., 295, 2000
1D89
  • Download 1d89
  • View 1d89
Molmil generated image of 1d89
A DNA DODECAMER CONTAINING AN ADENINE TRACT CRYSTALLIZES IN A UNIQUE LATTICE AND EXHIBITS A NEW BEND
Descriptor:DNA (5'-D(*CP*GP*CP*GP*AP*AP*AP*AP*AP*AP*CP*G)-3'), DNA (5'-D(*CP*GP*TP*TP*TP*TP*TP*TP*CP*GP*CP*G)-3')
Authors:DiGabriele, A.D., Steitz, T.A.
Deposit date:1992-07-17
Release date:1993-07-15
Last modified:2011-11-16
Method:X-RAY DIFFRACTION (2.3 Å)
Cite:A DNA dodecamer containing an adenine tract crystallizes in a unique lattice and exhibits a new bend.
J.Mol.Biol., 231, 1993
1DAR
  • Download 1dar
  • View 1dar
Molmil generated image of 1dar
ELONGATION FACTOR G IN COMPLEX WITH GDP
Descriptor:ELONGATION FACTOR G, GUANOSINE-5'-DIPHOSPHATE
Authors:Al-Karadaghi, S., Aevarsson, A., Garber, M., Zheltonosova, J., Liljas, A.
Deposit date:1996-02-15
Release date:1996-07-11
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:The structure of elongation factor G in complex with GDP: conformational flexibility and nucleotide exchange.
Structure, 4, 1996
1DFU
  • Download 1dfu
  • View 1dfu
Molmil generated image of 1dfu
CRYSTAL STRUCTURE OF E.COLI RIBOSOMAL PROTEIN L25 COMPLEXED WITH A 5S RRNA FRAGMENT AT 1.8 A RESOLUTION
Descriptor:5S RRNA, RIBOSOMAL PROTEIN L25, MAGNESIUM ION
Authors:Lu, M., Steitz, T.A.
Deposit date:1999-11-21
Release date:1999-12-02
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.8 Å)
Cite:Structure of Escherichia coli ribosomal protein L25 complexed with a 5S rRNA fragment at 1.8-A resolution.
Proc.Natl.Acad.Sci.USA, 97, 2000
1DPI
  • Download 1dpi
  • View 1dpi
Molmil generated image of 1dpi
STRUCTURE OF LARGE FRAGMENT OF ESCHERICHIA COLI DNA POLYMERASE I COMPLEXED WITH D/TMP
Descriptor:DNA POLYMERASE I KLENOW FRAGMENT, ZINC ION
Authors:Beese, L., Ollis, D., Steitz, T.
Deposit date:1987-08-11
Release date:1987-10-16
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.8 Å)
Cite:Structure of large fragment of Escherichia coli DNA polymerase I complexed with dTMP.
Nature, 313, 1985
1EFA
  • Download 1efa
  • View 1efa
Molmil generated image of 1efa
CRYSTAL STRUCTURE OF THE LAC REPRESSOR DIMER BOUND TO OPERATOR AND THE ANTI-INDUCER ONPF
Descriptor:DNA (5'-D(*GP*AP*AP*T*TP*GP*TP*GP*AP*GP*CP*GP*CP*TP*CP*AP*CP*AP*AP*TP*T)-3'), LAC REPRESSOR, ORTHONITROPHENYL-BETA-D-FUCOPYRANOSIDE
Authors:Bell, C.E., Lewis, M.
Deposit date:2000-02-07
Release date:2000-03-06
Last modified:2011-11-16
Method:X-RAY DIFFRACTION (2.6 Å)
Cite:A closer view of the conformation of the Lac repressor bound to operator.
Nat.Struct.Biol., 7, 2000
1EFG
  • Download 1efg
  • View 1efg
Molmil generated image of 1efg
THE CRYSTAL STRUCTURE OF ELONGATION FACTOR G COMPLEXED WITH GDP, AT 2.7 ANGSTROMS RESOLUTION
Descriptor:ELONGATION FACTOR G, GUANOSINE-5'-DIPHOSPHATE
Authors:Czworkowski, J., Wang, J., Steitz, T.A., Moore, P.B.
Deposit date:1994-10-17
Release date:1995-02-14
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:The crystal structure of elongation factor G complexed with GDP, at 2.7 A resolution.
EMBO J., 13, 1994
1ELO
  • Download 1elo
  • View 1elo
Molmil generated image of 1elo
ELONGATION FACTOR G WITHOUT NUCLEOTIDE
Descriptor:ELONGATION FACTOR G
Authors:Aevarsson, A., Brazhnikov, E., Garber, M., Zheltonosova, J., Chirgadze, Yu., Al-Karadaghi, S., Svensson, L.A., Liljas, A.
Deposit date:1996-03-13
Release date:1996-08-01
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.8 Å)
Cite:Three-dimensional structure of the ribosomal translocase: elongation factor G from Thermus thermophilus.
EMBO J., 13, 1994
1FFK
  • Download 1ffk
  • View 1ffk
Molmil generated image of 1ffk
CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Ban, N., Nissen, P., Hansen, J., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-25
Release date:2000-08-14
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
1FFY
  • Download 1ffy
  • View 1ffy
Molmil generated image of 1ffy
INSIGHTS INTO EDITING FROM AN ILE-TRNA SYNTHETASE STRUCTURE WITH TRNA(ILE) AND MUPIROCIN
Descriptor:ISOLEUCYL-TRNA, ISOLEUCYL-TRNA SYNTHETASE, POTASSIUM ION, ...
Authors:Silvian, L.F., Wang, J., Steitz, T.A.
Deposit date:2000-07-26
Release date:2000-08-07
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.2 Å)
Cite:Insights into editing from an ile-tRNA synthetase structure with tRNAile and mupirocin.
Science, 285, 1999
1FFZ
  • Download 1ffz
  • View 1ffz
Molmil generated image of 1ffz
LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN
Descriptor:23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU))
Authors:Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-26
Release date:2000-08-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.2 Å)
Cite:The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
1FG0
  • Download 1fg0
  • View 1fg0
Molmil generated image of 1fg0
LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND
Descriptor:23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'
Authors:Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-26
Release date:2000-08-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
1FNM
  • Download 1fnm
  • View 1fnm
Molmil generated image of 1fnm
STRUCTURE OF THERMUS THERMOPHILUS EF-G H573A
Descriptor:ELONGATION FACTOR G, MAGNESIUM ION, GUANOSINE-5'-DIPHOSPHATE
Authors:Laurberg, M., Kristensen, O., Martemyanov, K., Gudkov, A.T., Nagaev, I., Hughes, D., Liljas, A.
Deposit date:2000-08-22
Release date:2000-11-22
Last modified:2018-03-07
Method:X-RAY DIFFRACTION (2.8 Å)
Cite:Structure of a mutant EF-G reveals domain III and possibly the fusidic acid binding site.
J.Mol.Biol., 303, 2000
1G6N
  • Download 1g6n
  • View 1g6n
Molmil generated image of 1g6n
2.1 ANGSTROM STRUCTURE OF CAP-CAMP
Descriptor:CATABOLITE GENE ACTIVATOR PROTEIN, ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE
Authors:Passner, J.M., Schultz, S.C., Steitz, T.A.
Deposit date:2000-11-07
Release date:2000-12-15
Last modified:2017-10-04
Method:X-RAY DIFFRACTION (2.1 Å)
Cite:Modeling the cAMP-induced allosteric transition using the crystal structure of CAP-cAMP at 2.1 A resolution.
J.Mol.Biol., 304, 2000
1GDR
  • Download 1gdr
  • View 1gdr
Molmil generated image of 1gdr
MODEL FOR A DNA MEDIATED SYNAPTIC COMPLEX SUGGESTED BY CRYSTAL PACKING OF GAMMA DELTA RESOLVASE SUBUNITS
Descriptor:GAMMA DELTA-RESOLVASE
Authors:Rice, P.A., Steitz, T.A.
Deposit date:1993-08-31
Release date:1994-04-30
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.5 Å)
Cite:Model for a DNA-mediated synaptic complex suggested by crystal packing of gamma delta resolvase subunits.
EMBO J., 13, 1994
1GDT
  • Download 1gdt
  • View 1gdt
Molmil generated image of 1gdt
CRYSTAL STRUCTURE OF A SITE-SPECIFIC RECOMBINASE, GAMMA-DELTA RESOLVASE COMPLEXED WITH A 34 BP CLEAVAGE SITE
Descriptor:SITE I OF RES DNA, PROTEIN (GAMMA DELTA RESOLVASE)
Authors:Yang, W., Steitz, T.A.
Deposit date:1995-04-11
Release date:1996-04-03
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:Crystal structure of the site-specific recombinase gamma delta resolvase complexed with a 34 bp cleavage site.
Cell(Cambridge,Mass.), 82, 1995
1GO0
  • Download 1go0
  • View 1go0
Molmil generated image of 1go0
NMR STRUCTURE OF RIBOSOMAL PROTEIN L30E FROM THERMOCOCCUS CELER
Descriptor:50S RIBOSOMAL PROTEIN L30E
Authors:Chan, S.-H., Bycroft, M., Freund, S.M.V., Wong, K.-B.
Deposit date:2001-10-15
Release date:2003-06-12
Last modified:2018-01-24
Method:SOLUTION NMR
Cite:Solution Structure and Thermal Stability of Ribosomal Protein L30E from Hyperthermophilic Archaeon Thermococcus Celer
Protein Sci., 12, 2003