2EFG
| TRANSLATIONAL ELONGATION FACTOR G COMPLEXED WITH GDP | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, PROTEIN (ELONGATION FACTOR G DOMAIN 3), PROTEIN (ELONGATION FACTOR G) | Authors: | Czworkowski, J, Wang, J, Steitz, T.A, Moore, P.B. | Deposit date: | 1998-09-23 | Release date: | 1999-09-30 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | The crystal structure of elongation factor G complexed with GDP, at 2.7 A resolution. EMBO J., 13, 1994
|
|
3G6E
| Co-crystal structure of Homoharringtonine bound to the large ribosomal subunit | Descriptor: | (3beta)-O~3~-[(2R)-2,6-dihydroxy-2-(2-methoxy-2-oxoethyl)-6-methylheptanoyl]cephalotaxine, 23S ribosomal RNA, 50S ribosomal protein L10E, ... | Authors: | Gurel, G, Blaha, G, Moore, P.B, Steitz, T.A. | Deposit date: | 2009-02-06 | Release date: | 2009-04-28 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome. J.Mol.Biol., 389, 2009
|
|
3G71
| Co-crystal structure of Bruceantin bound to the large ribosomal subunit | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10E, 50S ribosomal protein L10e, ... | Authors: | Gurel, G, Blaha, G, Moore, P.B, Steitz, T.A. | Deposit date: | 2009-02-09 | Release date: | 2009-04-28 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (2.85 Å) | Cite: | U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome. J.Mol.Biol., 389, 2009
|
|
354D
| Structure of loop E FROM E. coli 5S RRNA | Descriptor: | MAGNESIUM ION, RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP*UP*G)-3'), RNA-DNA (5'-R(*GP*CP*GP*AP*GP*AP*GP*UP*AP*)-D(*DGP(S)*)-R(*GP*C)-3') | Authors: | Correll, C.C, Freeborn, B, Moore, P.B, Steitz, T.A. | Deposit date: | 1997-10-01 | Release date: | 1997-11-26 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Metals, motifs, and recognition in the crystal structure of a 5S rRNA domain. Cell(Cambridge,Mass.), 91, 1997
|
|
357D
| 3.5 A structure of fragment I from E. coli 5S RRNA | Descriptor: | MAGNESIUM ION, MERCURY (II) ION, RNA (5'-R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP*GP*AP*GP*UP*AP*GP*G P*GP*AP*AP*CP*UP* GP*CP*CP*AP*GP*GP*CP*AP*U)-3'), ... | Authors: | Correll, C.C, Freeborn, B, Moore, P.B, Steitz, T.A. | Deposit date: | 1997-10-09 | Release date: | 1997-12-01 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (3.5 Å) | Cite: | Metals, motifs, and recognition in the crystal structure of a 5S rRNA domain. Cell(Cambridge,Mass.), 91, 1997
|
|
364D
| 3.0 A STRUCTURE OF FRAGMENT I FROM E. COLI 5S RRNA | Descriptor: | MAGNESIUM ION, RNA (5'-R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP*GP*AP*GP*UP*AP*GP*G P*GP*AP*AP*CP*UP*GP*CP*CP*AP*GP*GP*CP*AP*U)-3'), RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP*UP*GP*UP*GP*GP*GP*G *UP*C)-3'), ... | Authors: | Correll, C.C, Freeborn, B, Moore, P.B, Steitz, T.A. | Deposit date: | 1997-12-08 | Release date: | 1998-01-02 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Metals, motifs, and recognition in the crystal structure of a 5S rRNA domain. Cell(Cambridge,Mass.), 91, 1997
|
|
1FFK
| CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-25 | Release date: | 2000-08-14 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution. Science, 289, 2000
|
|
1K73
| Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | Descriptor: | 23S RRNA, 5S RRNA, ANISOMYCIN, ... | Authors: | Hansen, J, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | Deposit date: | 2001-10-18 | Release date: | 2003-07-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3.01 Å) | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit J.Mol.Biol., 330, 2003
|
|
1K8A
| Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T. | Deposit date: | 2001-10-23 | Release date: | 2002-07-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol.Cell, 10, 2002
|
|
1KC8
| Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal Subunit | Descriptor: | 23S RRNA, 5S RRNA, BLASTICIDIN S, ... | Authors: | Hansen, J.L, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | Deposit date: | 2001-11-07 | Release date: | 2003-07-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3.01 Å) | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit J.Mol.Biol., 330, 2003
|
|
1MNX
| |
1N8R
| Structure of large ribosomal subunit in complex with virginiamycin M | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10e, 50S ribosomal protein L13P, ... | Authors: | Hansen, J.L, Moore, P.B, Steitz, T.A. | Deposit date: | 2002-11-21 | Release date: | 2003-07-22 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit J.Mol.Biol., 330, 2003
|
|
1NJI
| Structure of chloramphenicol bound to the 50S ribosomal subunit | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10e, 50S ribosomal protein L13P, ... | Authors: | Hansen, J.L, Moore, P.B, Steitz, T.A. | Deposit date: | 2002-12-31 | Release date: | 2003-07-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit J.Mol.Biol., 330, 2003
|
|
1FG0
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1FFZ
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
3I55
| Co-crystal structure of Mycalamide A Bound to the Large Ribosomal Subunit | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10E, 50S ribosomal protein L10e, ... | Authors: | Gurel, G, Blaha, G, Steitz, T.A, Moore, P.B. | Deposit date: | 2009-07-03 | Release date: | 2010-03-09 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (3.11 Å) | Cite: | Structures of triacetyloleandomycin and mycalamide A bind to the large ribosomal subunit of Haloarcula marismortui. Antimicrob.Agents Chemother., 53, 2009
|
|
3G4S
| Co-crystal structure of Tiamulin bound to the large ribosomal subunit | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10, 50S ribosomal protein L10e, ... | Authors: | Gurel, G, Blaha, G, Moore, P.B, Steitz, T.A. | Deposit date: | 2009-02-04 | Release date: | 2009-04-28 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome. J.Mol.Biol., 389, 2009
|
|
3I56
| Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal Subunit | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10E, 50S ribosomal protein L10e, ... | Authors: | Gurel, G, Blaha, G, Steitz, T.A, Moore, P.B. | Deposit date: | 2009-07-03 | Release date: | 2010-03-09 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Structures of triacetyloleandomycin and mycalamide A bind to the large ribosomal subunit of Haloarcula marismortui. Antimicrob.Agents Chemother., 53, 2009
|
|
1C04
| IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI | Descriptor: | 23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L11, RIBOSOMAL PROTEIN L14, ... | Authors: | Ban, N, Nissen, P, Capel, M, Moore, P.B, Steitz, T.A. | Deposit date: | 1999-07-14 | Release date: | 1999-08-31 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (5 Å) | Cite: | Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit. Nature, 400, 1999
|
|
2U2A
| |
1JJ2
| Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Klein, D.J, Schmeing, T.M, Moore, P.B, Steitz, T.A. | Deposit date: | 2001-07-03 | Release date: | 2001-08-01 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | The kink-turn: a new RNA secondary structure motif. EMBO J., 20, 2001
|
|
2A9L
| |
2PCW
| |
2PCV
| |
1WTS
| |