1QMU
| Duck carboxypeptidase D domain II | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, CARBOXYPEPTIDASE GP180 RESIDUES 503-882, SULFATE ION, ... | Authors: | Gomis-Rueth, F.X, Coll, M, Aviles, F.X, Vendrell, J, Fricker, L.D. | Deposit date: | 1999-10-06 | Release date: | 2000-10-13 | Last modified: | 2020-07-29 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal Structure of Avian Carboxypeptidase D Domain II : A Prototype for the Regulatory Metallocarboxypeptidase Subfamily Embo J., 18, 1999
|
|
1E9R
| Bacterial conjugative coupling protein TrwBdeltaN70. Trigonal form in complex with sulphate. | Descriptor: | CONJUGAL TRANSFER PROTEIN TRWB, SULFATE ION | Authors: | Gomis-Rueth, F.X, Moncalian, G, Cabezon, E, de la Cruz, F, Coll, M. | Deposit date: | 2000-10-26 | Release date: | 2001-02-06 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | The Bacterial Conjugation Protein Trwb Resembles Ring Helicases and F1-ATPase Nature, 409, 2001
|
|
1E9S
| Bacterial conjugative coupling protein TrwBdeltaN70. Unbound monoclinic form. | Descriptor: | CONJUGAL TRANSFER PROTEIN TRWB | Authors: | Gomis-Rueth, F.X, Moncalian, G, Cabezon, E, de la Cruz, F, Coll, M. | Deposit date: | 2000-10-26 | Release date: | 2001-02-06 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | The Bacterial Conjugation Protein Trwb Resembles Ring Helicases and F1-ATPase Nature, 409, 2001
|
|
1H8L
| Duck Carboxypeptidase D Domain II in complex with GEMSA | Descriptor: | (2-GUANIDINOETHYLMERCAPTO)SUCCINIC ACID, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | Authors: | Gomis-Rueth, F.X, Coll, M, Aviles, F.X, Vendrell, J, Fricker, L.D. | Deposit date: | 2001-02-09 | Release date: | 2002-02-08 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | The crystal structure of the inhibitor-complexed carboxypeptidase D domain II and the modeling of regulatory carboxypeptidases. J. Biol. Chem., 276, 2001
|
|
1EA4
| TRANSCRIPTIONAL REPRESSOR COPG/22bp dsDNA COMPLEX | Descriptor: | DNA (5'-D(*TP*AP*AP*CP*CP*GP*TP*GP *CP*AP*CP*TP*CP*AP*AP*TP*GP*CP*AP*AP*TP*C)-3'), DNA(5'-D(*AP*GP*AP*TP*TP*GP*CP*AP*TP *TP*GP*AP*GP*TP*GP*CP*AP*CP*GP*GP*TP*T)-3'), TRANSCRIPTIONAL REPRESSOR COPG | Authors: | Gomis-Rueth, F.X, Costa, M, Sola, M, Acebo, P, Eritja, R, Espinosa, M, Solar, G.D, Coll, M. | Deposit date: | 2000-11-05 | Release date: | 2001-07-05 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.95 Å) | Cite: | Plasmid Transcriptional Repressor Copg Oligomerises to Render Helical Superstructures Unbound and in Complexes with Oligonucleotides J.Mol.Biol., 310, 2001
|
|
2CPG
| TRANSCRIPTIONAL REPRESSOR COPG | Descriptor: | CHLORIDE ION, TRANSCRIPTIONAL REPRESSOR COPG | Authors: | Gomis-Rueth, F.X, Sola, M, Acebo, P, Parraga, A, Guasch, A, Eritja, R, Gonzalez, A, Espinosa, M, del Solar, G, Coll, M. | Deposit date: | 1999-11-15 | Release date: | 1999-11-19 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | The structure of plasmid-encoded transcriptional repressor CopG unliganded and bound to its operator. EMBO J., 17, 1998
|
|
1B01
| TRANSCRIPTIONAL REPRESSOR COPG/DNA COMPLEX | Descriptor: | DNA (5'-D(*CP*CP*CP*GP*TP*GP*CP*AP*CP*TP*CP*AP*AP*TP*GP*CP*AP*AP*T)-3'), DNA (5'-D(*GP*AP*TP*TP*GP*CP*AP*TP*TP*GP*AP*GP*TP*GP*CP*AP*CP*GP*G)-3'), TRANSCRIPTIONAL REPRESSOR COPG | Authors: | Gomis-Rueth, F.X, Sola, M, Acebo, P, Parraga, A, Guasch, A, Eritja, R, Gonzalez, A, Espinosa, M, del Solar, G, Coll, M. | Deposit date: | 1999-11-15 | Release date: | 1999-11-19 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.56 Å) | Cite: | The structure of plasmid-encoded transcriptional repressor CopG unliganded and bound to its operator. EMBO J., 17, 1998
|
|
2BO9
| Human carboxypeptidase A4 in complex with human latexin. | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 2-acetamido-2-deoxy-beta-D-glucopyranose, ACETONE, ... | Authors: | Pallares, I, Bonet, R, Garcia-Castellanos, R, Ventura, S, Aviles, F.X, Vendrell, J, Gomis-Rueth, F.X. | Deposit date: | 2005-04-08 | Release date: | 2005-04-15 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Structure of Human Carboxypeptidase A4 with its Endogenous Protein Inhibitor, Latexin. Proc.Natl.Acad.Sci.USA, 102, 2005
|
|
1AST
| |
1DYT
| X-ray crystal structure of ECP (RNase 3) at 1.75 A | Descriptor: | CITRIC ACID, EOSINOPHIL CATIONIC PROTEIN, FE (III) ION | Authors: | Mallorqui-Fernandez, G, Pous, J, Peracaula, R, Maeda, T, Tada, H, Yamada, H, Seno, M, De Llorens, R, Gomis-Rueth, F.X, Coll, M. | Deposit date: | 2000-02-08 | Release date: | 2001-02-08 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (1.75 Å) | Cite: | Three-Dimensional Crystal Structure of Human Eosinophil Cationic Protein (Rnase 3) at 1.75 A Resolution. J.Mol.Biol., 300, 2000
|
|
3AIG
| ADAMALYSIN II WITH PEPTIDOMIMETIC INHIBITOR POL656 | Descriptor: | (3R)-2-[N-(furan-2-ylcarbonyl)-L-leucyl]-2,3,4,9-tetrahydro-1H-beta-carboline-3-carboxylic acid, ADAMALYSIN II, CALCIUM ION, ... | Authors: | Gomis-Rueth, F.X, Meyer, E.F, Kress, L.F, Politi, V. | Deposit date: | 1997-10-12 | Release date: | 1998-04-15 | Last modified: | 2023-08-09 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Structures of adamalysin II with peptidic inhibitors. Implications for the design of tumor necrosis factor alpha convertase inhibitors. Protein Sci., 7, 1998
|
|
2AIG
| ADAMALYSIN II WITH PEPTIDOMIMETIC INHIBITOR POL647 | Descriptor: | ADAMALYSIN II, CALCIUM ION, N-(furan-2-ylcarbonyl)-L-leucyl-L-tryptophan, ... | Authors: | Gomis-Rueth, F.X, Meyer, E.F, Kress, L.F, Politi, V. | Deposit date: | 1997-10-12 | Release date: | 1998-04-15 | Last modified: | 2024-07-10 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structures of adamalysin II with peptidic inhibitors. Implications for the design of tumor necrosis factor alpha convertase inhibitors. Protein Sci., 7, 1998
|
|
1TMQ
| STRUCTURE OF TENEBRIO MOLITOR LARVAL ALPHA-AMYLASE IN COMPLEX WITH RAGI BIFUNCTIONAL INHIBITOR | Descriptor: | CALCIUM ION, CHLORIDE ION, PROTEIN (ALPHA-AMYLASE), ... | Authors: | Gomis-Rueth, F.X, Strobl, S, Glockshuber, R. | Deposit date: | 1998-01-13 | Release date: | 1999-03-02 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | A novel strategy for inhibition of alpha-amylases: yellow meal worm alpha-amylase in complex with the Ragi bifunctional inhibitor at 2.5 A resolution. Structure, 6, 1998
|
|
6I9A
| Porphyromonas gingivalis gingipain K (Kgp) in complex with inhibitor KYT-36 | Descriptor: | (2S,3S)-1,4-DIMERCAPTOBUTANE-2,3-DIOL, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, CALCIUM ION, ... | Authors: | Gomis-Ruth, F.X, Guevara, T, Rofdriguez-Banqueri, A. | Deposit date: | 2018-11-22 | Release date: | 2019-03-13 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.2 Å) | Cite: | Structural determinants of inhibition of Porphyromonas gingivalis gingipain K by KYT-36, a potent, selective, and bioavailable peptidase inhibitor. Sci Rep, 9, 2019
|
|
1IAG
| |
2BOA
| Human procarboxypeptidase A4. | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, CARBOXYPEPTIDASE A4, ... | Authors: | Garcia-Castellanos, R, Bonet-Figueredo, R, Pallares, I, Ventura, S, Aviles, F.X, Vendrell, J, Gomis-Ruth, F.X. | Deposit date: | 2005-04-08 | Release date: | 2005-12-13 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Detailed Molecular Comparison between the Inhibition Mode of A/B-Type Carboxypeptidases in the Zymogen State and by the Endogenous Inhibitor Latexin. Cell.Mol.Life Sci., 62, 2005
|
|
1IAC
| REFINED 1.8 ANGSTROMS X-RAY CRYSTAL STRUCTURE OF ASTACIN, A ZINC-ENDOPEPTIDASE FROM THE CRAYFISH ASTACUS ASTACUS L. STRUCTURE DETERMINATION, REFINEMENT, MOLECULAR STRUCTURE AND COMPARISON WITH THERMOLYSIN | Descriptor: | ASTACIN, MERCURY (II) ION | Authors: | Gomis-Rueth, F.-X, Stoecker, W, Bode, W. | Deposit date: | 1994-05-09 | Release date: | 1994-08-31 | Last modified: | 2024-06-05 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Refined 1.8 A X-ray crystal structure of astacin, a zinc-endopeptidase from the crayfish Astacus astacus L. Structure determination, refinement, molecular structure and comparison with thermolysin. J.Mol.Biol., 229, 1993
|
|
1IAA
| CRYSTAL STRUCTURES, SPECTROSCOPIC FEATURES, AND CATALYTIC PROPERTIES OF COBALT(II), COPPER(II), NICKEL(II), AND MERCURY(II) DERIVATIVES OF THE ZINC ENDOPEPTIDASE ASTACIN. A CORRELATION OF STRUCTURE AND PROTEOLYTIC ACTIVITY | Descriptor: | ASTACIN, COPPER (II) ION | Authors: | Gomis-Rueth, F.-X, Stoecker, W, Bode, W. | Deposit date: | 1994-05-09 | Release date: | 1994-08-31 | Last modified: | 2024-06-05 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Crystal structures, spectroscopic features, and catalytic properties of cobalt(II), copper(II), nickel(II), and mercury(II) derivatives of the zinc endopeptidase astacin. A correlation of structure and proteolytic activity. J.Biol.Chem., 269, 1994
|
|
1IAB
| CRYSTAL STRUCTURES, SPECTROSCOPIC FEATURES, AND CATALYTIC PROPERTIES OF COBALT(II), COPPER(II), NICKEL(II), AND MERCURY(II) DERIVATIVES OF THE ZINC ENDOPEPTIDASE ASTACIN. A CORRELATION OF STRUCTURE AND PROTEOLYTIC ACTIVITY | Descriptor: | ASTACIN, COBALT (II) ION | Authors: | Gomis-Rueth, F.-X, Stoecker, W, Bode, W. | Deposit date: | 1994-05-09 | Release date: | 1994-08-31 | Last modified: | 2024-06-05 | Method: | X-RAY DIFFRACTION (1.79 Å) | Cite: | Crystal structures, spectroscopic features, and catalytic properties of cobalt(II), copper(II), nickel(II), and mercury(II) derivatives of the zinc endopeptidase astacin. A correlation of structure and proteolytic activity. J.Biol.Chem., 269, 1994
|
|
1IAD
| REFINED 1.8 ANGSTROMS X-RAY CRYSTAL STRUCTURE OF ASTACIN, A ZINC-ENDOPEPTIDASE FROM THE CRAYFISH ASTACUS ASTACUS L. STRUCTURE DETERMINATION, REFINEMENT, MOLECULAR STRUCTURE AND COMPARISON TO THERMOLYSIN | Descriptor: | ASTACIN | Authors: | Gomis-Rueth, F.-X, Stoecker, W, Bode, W. | Deposit date: | 1994-05-09 | Release date: | 1994-08-31 | Last modified: | 2024-06-05 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Refined 1.8 A X-ray crystal structure of astacin, a zinc-endopeptidase from the crayfish Astacus astacus L. Structure determination, refinement, molecular structure and comparison with thermolysin. J.Mol.Biol., 229, 1993
|
|
1IAE
| CRYSTAL STRUCTURES, SPECTROSCOPIC FEATURES, AND CATALYTIC PROPERTIES OF COBALT(II), COPPER(II), NICKEL(II), AND MERCURY(II) DERIVATIVES OF THE ZINC ENDOPEPTIDASE ASTACIN. A CORRELATION OF STRUCTURE AND PROTEOLYTIC ACTIVITY | Descriptor: | ASTACIN, NICKEL (II) ION | Authors: | Grams, F, Stoecker, W, Bode, W. | Deposit date: | 1994-05-09 | Release date: | 1994-08-31 | Last modified: | 2024-06-05 | Method: | X-RAY DIFFRACTION (1.83 Å) | Cite: | Crystal structures, spectroscopic features, and catalytic properties of cobalt(II), copper(II), nickel(II), and mercury(II) derivatives of the zinc endopeptidase astacin. A correlation of structure and proteolytic activity. J.Biol.Chem., 269, 1994
|
|
1SAX
| Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2004-02-09 | Release date: | 2004-04-27 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279, 2004
|
|
1RNF
| X-RAY CRYSTAL STRUCTURE OF UNLIGANDED HUMAN RIBONUCLEASE 4 | Descriptor: | PROTEIN (RIBONUCLEASE 4) | Authors: | Terzyan, S.S, Peracaula, R, De Llorens, R, Tsushima, Y, Yamada, H, Seno, M, Gomis-Rueth, F.X, Coll, M. | Deposit date: | 1998-10-29 | Release date: | 1999-10-29 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | The three-dimensional structure of human RNase 4, unliganded and complexed with d(Up), reveals the basis for its uridine selectivity. J.Mol.Biol., 285, 1999
|
|
1JAE
| STRUCTURE OF TENEBRIO MOLITOR LARVAL ALPHA-AMYLASE | Descriptor: | ALPHA-AMYLASE, CALCIUM ION, CHLORIDE ION | Authors: | Strobl, S, Maskos, K, Betz, M, Wiegand, G, Huber, R, Gomis-Rueth, F.X, Frank, G, Glockshuber, R. | Deposit date: | 1997-09-30 | Release date: | 1998-11-04 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (1.65 Å) | Cite: | Crystal structure of yellow meal worm alpha-amylase at 1.64 A resolution. J.Mol.Biol., 278, 1998
|
|
1KBC
| PROCARBOXYPEPTIDASE TERNARY COMPLEX | Descriptor: | 3-AMINO-AZACYCLOTRIDECAN-2-ONE, 3-FORMYL-2-HYDROXY-5-METHYL-HEXANOIC ACID HYDROXYAMIDE, CALCIUM ION, ... | Authors: | Betz, M, Gomis-Rueth, F.X, Bode, W. | Deposit date: | 1997-04-29 | Release date: | 1997-08-12 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | 1.8-A crystal structure of the catalytic domain of human neutrophil collagenase (matrix metalloproteinase-8) complexed with a peptidomimetic hydroxamate primed-side inhibitor with a distinct selectivity profile. Eur.J.Biochem., 247, 1997
|
|