1SD6
 
 | | Crystal Structure of Native MecI at 2.65 A | | Descriptor: | Methicillin resistance regulatory protein mecI | | Authors: | Safo, M.K, Zhao, Q, Musayev, F.N, Robinson, H, Scarsdale, N, Archer, G.L. | | Deposit date: | 2004-02-13 | | Release date: | 2004-02-24 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Crystal structures of the BlaI repressor from Staphylococcus aureus and its complex with DNA: insights into transcriptional regulation of the bla and mec operons
J.Bacteriol., 187, 2005
|
|
1SD7
 | | Crystal Structure of a SeMet derivative of MecI at 2.65 A | | Descriptor: | Methicillin resistance regulatory protein mecI | | Authors: | Safo, M.K, Zhao, Q, Musayev, F.N, Robinson, H, Scarsdale, N, Archer, G.L. | | Deposit date: | 2004-02-13 | | Release date: | 2004-02-24 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Crystal structures of the BlaI repressor from Staphylococcus aureus and its complex with DNA: insights into transcriptional regulation of the bla and mec operons
J.Bacteriol., 187, 2005
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
