1OKR
 
 | | Three-dimensional structure of S.aureus methicillin-resistance regulating transcriptional repressor MecI. | | Descriptor: | CHLORIDE ION, GLYCEROL, METHICILLIN RESISTANCE REGULATORY PROTEIN MECI | | Authors: | Garcia-Castellanos, R, Marrero, A, Mallorqui-Fernandez, G, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2003-07-28 | | Release date: | 2003-10-09 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Three-Dimensional Structure of Meci: Molecular Basis for Transcriptional Regulation of Staphylococcal Methicillin Resistance
J.Biol.Chem., 278, 2003
|
|
1SD6
 | | Crystal Structure of Native MecI at 2.65 A | | Descriptor: | Methicillin resistance regulatory protein mecI | | Authors: | Safo, M.K, Zhao, Q, Musayev, F.N, Robinson, H, Scarsdale, N, Archer, G.L. | | Deposit date: | 2004-02-13 | | Release date: | 2004-02-24 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Crystal structures of the BlaI repressor from Staphylococcus aureus and its complex with DNA: insights into transcriptional regulation of the bla and mec operons
J.Bacteriol., 187, 2005
|
|
1SD7
 | | Crystal Structure of a SeMet derivative of MecI at 2.65 A | | Descriptor: | Methicillin resistance regulatory protein mecI | | Authors: | Safo, M.K, Zhao, Q, Musayev, F.N, Robinson, H, Scarsdale, N, Archer, G.L. | | Deposit date: | 2004-02-13 | | Release date: | 2004-02-24 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Crystal structures of the BlaI repressor from Staphylococcus aureus and its complex with DNA: insights into transcriptional regulation of the bla and mec operons
J.Bacteriol., 187, 2005
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
2D45
 | | Crystal structure of the MecI-mecA repressor-operator complex | | Descriptor: | 5'-D(P*TP*AP*CP*TP*AP*CP*AP*TP*AP*TP*GP*TP*AP*GP*TP*A)-3', Methicillin resistance regulatory protein mecI | | Authors: | Safo, M.K, Ko, T.-P, Musayev, F.N, Zhao, Q, Wang, A.H.-J, Archer, G.L. | | Deposit date: | 2005-10-09 | | Release date: | 2005-10-25 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (3.8 Å) | | Cite: | Structure of the MecI repressor from Staphylococcus aureus in complex with the cognate DNA operator of mec.
Acta Crystallogr.,Sect.F, 62, 2006
|
|
