1FFK
 
 | | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-25 | | Release date: | 2000-08-14 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1KC8
 | | Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal Subunit | | Descriptor: | 23S RRNA, 5S RRNA, BLASTICIDIN S, ... | | Authors: | Hansen, J.L, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | | Deposit date: | 2001-11-07 | | Release date: | 2003-07-22 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3.01 Å) | | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
|
|
1K73
 | | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | | Descriptor: | 23S RRNA, 5S RRNA, ANISOMYCIN, ... | | Authors: | Hansen, J, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | | Deposit date: | 2001-10-18 | | Release date: | 2003-07-22 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3.01 Å) | | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
|
|
1K8A
 | | Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T. | | Deposit date: | 2001-10-23 | | Release date: | 2002-07-19 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit.
Mol.Cell, 10, 2002
|
|
1N8R
 | | Structure of large ribosomal subunit in complex with virginiamycin M | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10e, 50S ribosomal protein L13P, ... | | Authors: | Hansen, J.L, Moore, P.B, Steitz, T.A. | | Deposit date: | 2002-11-21 | | Release date: | 2003-07-22 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
|
|
1NJI
 | | Structure of chloramphenicol bound to the 50S ribosomal subunit | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10e, 50S ribosomal protein L13P, ... | | Authors: | Hansen, J.L, Moore, P.B, Steitz, T.A. | | Deposit date: | 2002-12-31 | | Release date: | 2003-07-22 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
|
|
4V9F
 | |
1H7M
 | | Ribosomal Protein L30e from Thermococcus celer | | Descriptor: | 50S RIBOSOMAL PROTEIN L30E | | Authors: | Chen, Y.W, Wong, K.B. | | Deposit date: | 2001-07-09 | | Release date: | 2003-04-04 | | Last modified: | 2024-05-01 | | Method: | X-RAY DIFFRACTION (1.96 Å) | | Cite: | Crystal Structure of Ribosomal Protein L30E from the Extreme Thermophile Thermocccus Celer: Thermal Stability and RNA Binding
Biochemistry, 42, 2003
|
|
1GO1
 | |
1GO0
 | |
