1R1T
 
 | | Crystal structure of the cyanobacterial metallothionein repressor SmtB in the apo-form | | Descriptor: | Transcriptional repressor smtB | | Authors: | Eicken, C, Pennella, M.A, Chen, X, Koshlap, K.M, VanZile, M.L, Sacchettini, J.C, Giedroc, D.P. | | Deposit date: | 2003-09-25 | | Release date: | 2004-05-18 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | A metal-ligand-mediated intersubunit allosteric switch in related SmtB/ArsR zinc sensor proteins.
J.Mol.Biol., 333, 2003
|
|
1SJW
 | | Structure of polyketide cyclase SnoaL | | Descriptor: | METHYL 5,7-DIHYDROXY-2-METHYL-4,6,11-TRIOXO-3,4,6,11-TETRAHYDROTETRACENE-1-CARBOXYLATE, nogalonic acid methyl ester cyclase | | Authors: | Sultana, A, Kallio, P, Jansson, A, Wang, J.S, Neimi, J, Mantsala, P, Schneider, G, Structural Proteomics in Europe (SPINE) | | Deposit date: | 2004-03-04 | | Release date: | 2004-04-27 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (1.35 Å) | | Cite: | Structure of the polyketide cyclase SnoaL reveals a novel mechanism for enzymatic aldol condensation.
Embo J., 23, 2004
|
|
1SR8
 | | Structural Genomics, 1.9A crystal structure of cobalamin biosynthesis protein (cbiD) from Archaeoglobus fulgidus | | Descriptor: | cobalamin biosynthesis protein (cbiD) | | Authors: | Zhang, R, Skarina, T, Savchenko, A, Edwards, A, Joachimiak, A, Midwest Center for Structural Genomics (MCSG) | | Deposit date: | 2004-03-22 | | Release date: | 2004-08-03 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | 1.9A crystal structure of cobalamin biosynthesis protein (cbiD) from Archaeoglobus fulgidus
To be Published
|
|
1R9J
 | | Transketolase from Leishmania mexicana | | Descriptor: | CALCIUM ION, THIAMINE DIPHOSPHATE, transketolase | | Authors: | Veitch, N.J, Mauger, D.A, Cazzulo, J.J, Lindqvist, Y, Barrett, M.P. | | Deposit date: | 2003-10-30 | | Release date: | 2004-11-09 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.22 Å) | | Cite: | Transketolase from Leishmania mexicana has a dual subcellular localization.
Biochem.J., 382, 2004
|
|
1RU0
 | | Crystal structure of DCoH2, a paralog of DCoH, the Dimerization Cofactor of HNF-1 | | Descriptor: | DcoH-like protein DCoHm | | Authors: | Rose, R.B, Pullen, K.E, Bayle, J.H, Crabtree, G.R, Alber, T. | | Deposit date: | 2003-12-10 | | Release date: | 2004-10-12 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Biochemical and structural basis for partially redundant enzymatic and transcriptional functions of DCoH and DCoH2
Biochemistry, 43, 2004
|
|
1RIY
 | |
1RMQ
 | | Crystal structure of AphA class B acid phosphatase/phosphotransferase with osmiate mimicking the catalytic intermediate | | Descriptor: | COBALT (II) ION, Class B acid phosphatase, OSMIUM ION | | Authors: | Calderone, V, Forleo, C, Benvenuti, M, Rossolini, G.M, Thaller, M.C, Mangani, S. | | Deposit date: | 2003-11-28 | | Release date: | 2004-12-14 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Insights in the catalytic mechanism of AphA from Escherichia coli
To be Published
|
|
1RI6
 | | Structure of a putative isomerase from E. coli | | Descriptor: | putative isomerase ybhE | | Authors: | Lima, C.D, Kniewel, R, Solorzano, V, Wu, J, Burley, S.K, New York SGX Research Center for Structural Genomics (NYSGXRC) | | Deposit date: | 2003-11-16 | | Release date: | 2003-11-25 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Structure of a putative 7-bladed propeller isomerase
To be Published
|
|
1RXA
 | |
1SJR
 | | NMR Structure of RRM2 from Human Polypyrimidine Tract Binding Protein Isoform 1 (PTB1) | | Descriptor: | Polypyrimidine tract-binding protein 1 | | Authors: | Simpson, P.J, Monie, T.P, Szendroi, A, Davydova, N, Tyzack, J.K, Conte, M.R, Read, C.M, Cary, P.D, Svergun, D.I, Konarev, P.V, Petoukhov, M.V, Curry, S, Matthews, S.J. | | Deposit date: | 2004-03-04 | | Release date: | 2004-09-14 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Structure and RNA Interactions of the N-Terminal RRM Domains of PTB
Structure, 12, 2004
|
|
1RYZ
 | | Uridine Phosphorylase from Salmonella typhimurium. Crystal Structure at 2.9 A Resolution | | Descriptor: | ACETIC ACID, Uridine phosphorylase | | Authors: | Dontsova, M.V, Gabdoulkhakov, A.G, Lyashenko, A.V, Nikonov, S.V, Ealick, S.E, Mikhailov, A.M. | | Deposit date: | 2003-12-23 | | Release date: | 2004-12-28 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structure-functions studies of uridine phosphorylase from Salmonella typhimurium
TO BE PUBLISHED
|
|
1S1A
 | | Pterocarpus angolensis seed lectin (PAL) with one binding site free and one binding site containing the disaccharide Man(a1-3)ManMe | | Descriptor: | CALCIUM ION, Lectin, MANGANESE (II) ION, ... | | Authors: | Buts, L, Imberty, A, Wyns, L, Beeckmans, S, Loris, R. | | Deposit date: | 2004-01-06 | | Release date: | 2005-01-18 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: |
|
|
1RXB
 | |
1SEN
 | | Endoplasmic reticulum protein Rp19 O95881 | | Descriptor: | CHLORIDE ION, PLATINUM (II) ION, Thioredoxin-like protein p19 | | Authors: | Liu, Z.-J, Chen, L, Tempel, W, Shah, A, Lee, D, Dailey, T.A, Mayer, M.R, Rose, J.P, Richardson, D.C, Richardson, J.S, Dailey, H.A, Wang, B.-C, Southeast Collaboratory for Structural Genomics (SECSG) | | Deposit date: | 2004-02-17 | | Release date: | 2004-07-13 | | Last modified: | 2017-10-11 | | Method: | X-RAY DIFFRACTION (1.199 Å) | | Cite: | Endoplasmic reticulum protein Rp19
To be Published
|
|
1S75
 | | SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING AN ALPHA-ANOMERIC ADENOSINE: INSIGHTS INTO SUBSTRATE RECOGNITION BY ENDONUCLEASE IV | | Descriptor: | 5'-D(*CP*GP*TP*CP*GP*TP*GP*GP*AP*C)-3', 5'-D(*GP*TP*CP*CP*(A3A)P*CP*GP*AP*CP*G)-3' | | Authors: | Aramini, J.M, Cleaver, S.H, Pon, R.T, Cunningham, R.P, Germann, M.W. | | Deposit date: | 2004-01-28 | | Release date: | 2004-04-20 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Solution Structure of a DNA Duplex Containing an alpha-Anomeric Adenosine: Insights into Substrate Recognition by Endonuclease IV.
J.Mol.Biol., 338, 2004
|
|
1S8F
 | |
1S94
 | |
1SAW
 | | X-ray structure of homo sapiens protein FLJ36880 | | Descriptor: | CHLORIDE ION, MAGNESIUM ION, hypothetical protein FLJ36880 | | Authors: | Manjasetty, B.A, Niesen, F.H, Delbrueck, H, Goetz, F, Sievert, V, Buessow, K, Behlke, J, Heinemann, U. | | Deposit date: | 2004-02-09 | | Release date: | 2004-10-12 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | X-ray structure of fumarylacetoacetate hydrolase family member Homo sapiens FLJ36880.
Biol.Chem., 385, 2004
|
|
1T65
 | | Crystal structure of the androgen receptor ligand binding domain with DHT and a peptide derived form its physiological coactivator GRIP1 NR box 2 bound in a non-helical conformation | | Descriptor: | 5-ALPHA-DIHYDROTESTOSTERONE, Androgen receptor, Nuclear receptor coactivator 2 | | Authors: | Estebanez-Perpina, E, Moore, J.M.R, Mar, E, Nguyen, P, Delgado-Rodrigues, E, Baxter, J.D, Webb, P, Fletterick, R.J, Guy, R.K. | | Deposit date: | 2004-05-05 | | Release date: | 2005-01-25 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.66 Å) | | Cite: | The Molecular Mechanisms of Coactivator Utilization in Ligand-dependent Transactivation by the Androgen Receptor.
J.Biol.Chem., 280, 2005
|
|
1TD4
 | | Crystal structure of VSHP_BPP21 in space group H3 with high resolution. | | Descriptor: | Head decoration protein | | Authors: | Chang, C, Forrer, P, Ott, D, Wlodawer, A, Plueckthun, A. | | Deposit date: | 2004-05-21 | | Release date: | 2004-11-02 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Kinetic Stability and Crystal Structure of the Viral Capsid Protein SHP.
J.Mol.Biol., 344, 2004
|
|
1R74
 | | Crystal Structure of Human Glycine N-Methyltransferase | | Descriptor: | BETA-MERCAPTOETHANOL, CITRIC ACID, Glycine N-methyltransferase | | Authors: | Pakhomova, S, Luka, Z, Wagner, C, Newcomer, M.E. | | Deposit date: | 2003-10-17 | | Release date: | 2004-09-21 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.55 Å) | | Cite: | Glycine N-methyltransferases: a comparison of the crystal structures and kinetic properties of recombinant human, mouse and rat enzymes.
Proteins, 57, 2004
|
|
1R7W
 | | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1RGX
 | | Crystal Structure of resisitin | | Descriptor: | Resistin | | Authors: | Patel, S.D, Rajala, M.W, Scherer, P.E, Shapiro, L, Burley, S.K, New York SGX Research Center for Structural Genomics (NYSGXRC) | | Deposit date: | 2003-11-13 | | Release date: | 2004-06-08 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.787 Å) | | Cite: | Disulfide-dependent multimeric assembly of resistin family hormones
Science, 304, 2004
|
|
1RI3
 | | Structure and mechanism of mRNA cap (guanine N-7) methyltransferase | | Descriptor: | S-ADENOSYL-L-HOMOCYSTEINE, mRNA CAPPING ENZYME | | Authors: | Fabrega, C, Hausmann, S, Shen, V, Shuman, S, Lima, C.D. | | Deposit date: | 2003-11-16 | | Release date: | 2004-02-03 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Structure and mechanism of mRNA cap (Guanine-n7) methyltransferase
Mol.Cell, 13, 2004
|
|
1RJX
 | | Human PLASMINOGEN CATALYTIC DOMAIN, K698M MUTANT | | Descriptor: | Plasminogen, SULFATE ION | | Authors: | Terzyan, S, Wakeham, N, Zhai, P, Rodgers, K, Zhang, X.C. | | Deposit date: | 2003-11-20 | | Release date: | 2003-12-02 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Characterization of Lys-698 to met substitution in human plasminogen catalytic domain
Proteins, 56, 2004
|
|
