2D90
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2d90 by Molmil](/molmil-images/mine/2d90) | |
2D3B
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2d3b by Molmil](/molmil-images/mine/2d3b) | Crystal Structure of the Maize Glutamine Synthetase complexed with AMPPNP and Methionine sulfoximine | Descriptor: | (2S)-2-AMINO-4-(METHYLSULFONIMIDOYL)BUTANOIC ACID, MANGANESE (II) ION, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER, ... | Authors: | Unno, H, Uchida, T, Sugawara, H, Kurisu, G, Sugiyama, T, Yamaya, T, Sakakibara, H, Hase, T, Kusunoki, M. | Deposit date: | 2005-09-26 | Release date: | 2006-07-18 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (3.5 Å) | Cite: | Atomic Structure of Plant Glutamine Synthetase: A KEY ENZYME FOR PLANT PRODUCTIVITY J.Biol.Chem., 281, 2006
|
|
2D3A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2d3a by Molmil](/molmil-images/mine/2d3a) | Crystal Structure of the Maize Glutamine Synthetase complexed with ADP and Methionine sulfoximine Phosphate | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, L-METHIONINE-S-SULFOXIMINE PHOSPHATE, MANGANESE (II) ION, ... | Authors: | Unno, H, Uchida, T, Sugawara, H, Kurisu, G, Sugiyama, T, Yamaya, T, Sakakibara, H, Hase, T, Kusunoki, M. | Deposit date: | 2005-09-26 | Release date: | 2006-07-18 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.63 Å) | Cite: | Atomic Structure of Plant Glutamine Synthetase: A KEY ENZYME FOR PLANT PRODUCTIVITY J.Biol.Chem., 281, 2006
|
|
2D45
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2d45 by Molmil](/molmil-images/mine/2d45) | Crystal structure of the MecI-mecA repressor-operator complex | Descriptor: | 5'-D(P*TP*AP*CP*TP*AP*CP*AP*TP*AP*TP*GP*TP*AP*GP*TP*A)-3', Methicillin resistance regulatory protein mecI | Authors: | Safo, M.K, Ko, T.-P, Musayev, F.N, Zhao, Q, Wang, A.H.-J, Archer, G.L. | Deposit date: | 2005-10-09 | Release date: | 2005-10-25 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (3.8 Å) | Cite: | Structure of the MecI repressor from Staphylococcus aureus in complex with the cognate DNA operator of mec. Acta Crystallogr.,Sect.F, 62, 2006
|
|
2D8O
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2d8o by Molmil](/molmil-images/mine/2d8o) | Structure of VIL-thaumatin | Descriptor: | IODIDE ION, Thaumatin I | Authors: | Miyatake, H, Hasegawa, T, Yamano, A. | Deposit date: | 2005-12-07 | Release date: | 2006-07-11 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.38 Å) | Cite: | New methods to prepare iodinated derivatives by vaporizing iodine labelling (VIL) and hydrogen peroxide VIL (HYPER-VIL) ACTA CRYSTALLOGR.,SECT.D, 62, 2006
|
|
2D3C
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2d3c by Molmil](/molmil-images/mine/2d3c) | Crystal Structure of the Maize Glutamine Synthetase complexed with ADP and Phosphinothricin Phosphate | Descriptor: | (2S)-2-AMINO-4-[METHYL(PHOSPHONOOXY)PHOSPHORYL]BUTANOIC ACID, ADENOSINE-5'-DIPHOSPHATE, MANGANESE (II) ION, ... | Authors: | Unno, H, Uchida, T, Sugawara, H, Kurisu, G, Sugiyama, T, Yamaya, T, Sakakibara, H, Hase, T, Kusunoki, M. | Deposit date: | 2005-09-26 | Release date: | 2006-07-18 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (3.81 Å) | Cite: | Atomic Structure of Plant Glutamine Synthetase: A KEY ENZYME FOR PLANT PRODUCTIVITY J.Biol.Chem., 281, 2006
|
|
2DGL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2dgl by Molmil](/molmil-images/mine/2dgl) | Crystal structure of Escherichia coli GadB in complex with bromide | Descriptor: | ACETIC ACID, BROMIDE ION, Glutamate decarboxylase beta, ... | Authors: | Gruetter, M.G, Capitani, G, Gut, H. | Deposit date: | 2006-03-14 | Release date: | 2006-06-20 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (3.15 Å) | Cite: | Escherichia coli acid resistance: pH-sensing, activation by chloride and autoinhibition in GadB Embo J., 25, 2006
|
|
1PF9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1pf9 by Molmil](/molmil-images/mine/1pf9) | GroEL-GroES-ADP | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, groEL protein, ... | Authors: | Chaudhry, C, Farr, G.W, Todd, M.J, Rye, H.S, Brunger, A.T, Adams, P.D, Horwich, A.L, Sigler, P.B. | Deposit date: | 2003-05-24 | Release date: | 2003-11-04 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.993 Å) | Cite: | Role of the gamma-phosphate of ATP in triggering protein folding by GroEL-GroES: function, structure and energetics. Embo J., 22, 2003
|
|
1PCQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1pcq by Molmil](/molmil-images/mine/1pcq) | Crystal structure of groEL-groES | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, ALUMINUM FLUORIDE, MAGNESIUM ION, ... | Authors: | Chaudhry, C, Farr, G.W, Todd, M.J, Rye, H.S, Brunger, A.T, Adams, P.D, Horwich, A.L, Sigler, P.B. | Deposit date: | 2003-05-16 | Release date: | 2003-10-14 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.808 Å) | Cite: | Role of the gamma-phosphate of ATP in triggering protein folding by GroEL-GroES: function, structure and energetics. Embo J., 22, 2003
|
|
1QWD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwd by Molmil](/molmil-images/mine/1qwd) | CRYSTAL STRUCTURE OF A BACTERIAL LIPOCALIN, THE BLC GENE PRODUCT FROM E. COLI | Descriptor: | Outer membrane lipoprotein blc | Authors: | Campanacci, V, Nurizzo, D, Spinelli, S, Valencia, C, Cambillau, C. | Deposit date: | 2003-09-02 | Release date: | 2004-04-06 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.75 Å) | Cite: | The crystal structure of the Escherichia coli lipocalin Blc suggests a possible role in phospholipid binding Febs Lett., 562, 2004
|
|
1QWM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwm by Molmil](/molmil-images/mine/1qwm) | Structure of Helicobacter pylori catalase with formic acid bound | Descriptor: | AZIDE ION, FORMIC ACID, KatA catalase, ... | Authors: | Loewen, P.C, Carpena, X, Perez-Luque, R, Rovira, C, Haas, R, Odenbreit, S, Nicholls, P, Fita, I. | Deposit date: | 2003-09-02 | Release date: | 2004-03-30 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Structure of Helicobacter pylori Catalase, with and without Formic Acid Bound, at 1.6 A Resolution Biochemistry, 43, 2004
|
|
1R0B
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1r0b by Molmil](/molmil-images/mine/1r0b) | Aspartate Transcarbamylase (ATCase) of Escherichia coli: A New Crystalline R State Bound to PALA, or to Product Analogues Phosphate and Citrate | Descriptor: | Aspartate carbamoyltransferase catalytic chain, Aspartate carbamoyltransferase regulatory chain, CITRATE ANION, ... | Authors: | Huang, J, Lipscomb, W.N. | Deposit date: | 2003-09-19 | Release date: | 2004-06-08 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Aspartate Transcarbamylase (ATCase) of Escherichia coli: A New Crystalline R-State Bound to PALA, or to Product Analogues Citrate and Phosphate Biochemistry, 43, 2004
|
|
1Q6A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1q6a by Molmil](/molmil-images/mine/1q6a) | Solution Structure of the C-terminal Domain of Thermosynechococcus elongatus KaiA (ThKaiA180C); Averaged Minimized Structure | Descriptor: | Circadian clock protein KaiA homolog | Authors: | Vakonakis, I, Sun, J, Holzenburg, A, Golden, S.S, LiWang, A.C. | Deposit date: | 2003-08-13 | Release date: | 2003-08-19 | Last modified: | 2011-07-13 | Method: | SOLUTION NMR | Cite: | NMR structure of the KaiC-interacting C-terminal domain of KaiA, a circadian clock protein: Implications for KaiA-KaiC interaction Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
1OII
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1oii by Molmil](/molmil-images/mine/1oii) | Crystal structure of the alkylsulfatase AtsK, a non-heme Fe(II) alphaketoglutarate dependent Dioxygenase in complex with iron and alphaketoglutarate | Descriptor: | 2-OXOGLUTARIC ACID, FE (II) ION, PUTATIVE ALKYLSULFATASE ATSK | Authors: | Mueller, I, Kahnert, A, Pape, T, Dierks, T, Meyer-Klauke, W, Kertesz, M.A, Uson, I. | Deposit date: | 2003-06-18 | Release date: | 2004-03-30 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.19 Å) | Cite: | Crystal Structure of the Alkylsulfatase Atsk: Insights Into the Catalytic Mechanism of the Fe(II) Alpha-Ketoglutarate-Dependent Dioxygenase Superfamily Biochemistry, 42, 2004
|
|
1QWA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwa by Molmil](/molmil-images/mine/1qwa) | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Descriptor: | 18S ribosomal RNA, 5'ETS | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | Deposit date: | 2003-09-01 | Release date: | 2003-11-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
|
|
1QZV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qzv by Molmil](/molmil-images/mine/1qzv) | Crystal structure of plant photosystem I | Descriptor: | CHLOROPHYLL A, IRON/SULFUR CLUSTER, PHYLLOQUINONE, ... | Authors: | Ben-Shem, A, Frolow, F, Nelson, N. | Deposit date: | 2003-09-18 | Release date: | 2004-01-06 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (4.44 Å) | Cite: | Crystal structure of plant photosystem I. Nature, 426, 2003
|
|
1QMH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qmh by Molmil](/molmil-images/mine/1qmh) | Crystal structure of RNA 3'-terminal phosphate cyclase, an ubiquitous enzyme with unusual topology | Descriptor: | 1-HYDROXYSULFANYL-4-MERCAPTO-BUTANE-2,3-DIOL, CITRIC ACID, RNA 3'-TERMINAL PHOSPHATE CYCLASE | Authors: | Palm, G.J, Billy, E, Filipowicz, W, Wlodawer, A. | Deposit date: | 1999-09-28 | Release date: | 2000-01-11 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Crystal Structure of RNA 3'-Terminal Phosphate Cyclase, a Ubiquitous Enzyme with Unusual Topology Structure, 8, 2000
|
|
1RXS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1rxs by Molmil](/molmil-images/mine/1rxs) | E. coli uridine phosphorylase: 2'-deoxyuridine phosphate complex | Descriptor: | 2'-DEOXYURIDINE, META VANADATE, PHOSPHATE ION, ... | Authors: | Caradoc-Davies, T.T, Cutfield, S.M, Lamont, I.L, Cutfield, J.F. | Deposit date: | 2003-12-18 | Release date: | 2004-04-13 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal structures of escherichia coli uridine phosphorylase in two native and three complexed forms reveal basis of substrate specificity, induced conformational changes and influence of potassium J.Mol.Biol., 337, 2004
|
|
1S67
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1s67 by Molmil](/molmil-images/mine/1s67) | Crystal structure of heme domain of direct oxygen sensor from E. coli | Descriptor: | Hypothetical protein yddU, OXYGEN MOLECULE, PROTOPORPHYRIN IX CONTAINING FE | Authors: | Park, H.J, Suquet, C, Satterlee, J.D, Kang, C.H. | Deposit date: | 2004-01-22 | Release date: | 2004-06-22 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Insights into signal transduction involving PAS domain oxygen-sensing heme proteins from the X-ray crystal structure of Escherichia coli Dos heme domain (Ec DosH) Biochemistry, 43, 2004
|
|
1QWB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwb by Molmil](/molmil-images/mine/1qwb) | |
1QQD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qqd by Molmil](/molmil-images/mine/1qqd) | |
1QYC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qyc by Molmil](/molmil-images/mine/1qyc) | Crystal structures of pinoresinol-lariciresinol and phenylcoumaran benzylic ether reductases, and their relationship to isoflavone reductases | Descriptor: | phenylcoumaran benzylic ether reductase PT1 | Authors: | Min, T, Kasahara, H, Bedgar, D.L, Youn, B, Lawrence, P.K, Gang, D.R, Halls, S.C, Park, H, Hilsenbeck, J.L, Davin, L.B, Kang, C. | Deposit date: | 2003-09-10 | Release date: | 2003-11-04 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Crystal structures of pinoresinol-lariciresinol and phenylcoumaran benzylic ether reductases and their relationship to isoflavone reductases. J.Biol.Chem., 278, 2003
|
|
1RKT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1rkt by Molmil](/molmil-images/mine/1rkt) | Crystal structure of yfiR, a putative transcriptional regulator from Bacillus subtilis | Descriptor: | UNKNOWN ATOM OR ION, protein yfiR | Authors: | Anderson, W.F, Rajan, S.S, Yang, X, Midwest Center for Structural Genomics (MCSG) | Deposit date: | 2003-11-23 | Release date: | 2004-04-13 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (1.95 Å) | Cite: | Crystal structure of YfiR, an unusual TetR/CamR-type putative transcriptional regulator from Bacillus subtilis. Proteins, 65, 2006
|
|
1Q97
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1q97 by Molmil](/molmil-images/mine/1q97) | The structure of the Saccharomyces cerevisiae SR protein kinase, Sky1p, with bound ATP | Descriptor: | ADENOSINE, ADENOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, ... | Authors: | Nolen, B, Ngo, J, Chakrabarti, S, Vu, D, Adams, J.A, Ghosh, G. | Deposit date: | 2003-08-22 | Release date: | 2003-09-23 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Nucleotide-Induced Conformational Changes in the Saccharomyces cerevisiae SR Protein Kinase, Sky1p, Revealed by X-ray Crystallography Biochemistry, 42, 2003
|
|
1Q6B
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1q6b by Molmil](/molmil-images/mine/1q6b) | Solution Structure of the C-terminal Domain of Thermosynechococcus elongatus KaiA (ThKaiA180C); Ensemble of 25 Structures | Descriptor: | Circadian clock protein KaiA homolog | Authors: | Vakonakis, I, Sun, J, Golden, S.S, Holzenburg, A, LiWang, A.C. | Deposit date: | 2003-08-13 | Release date: | 2003-08-19 | Last modified: | 2011-07-13 | Method: | SOLUTION NMR | Cite: | NMR structure of the KaiC-interacting C-terminal domain of KaiA, a circadian clock protein: implications for KaiA-KaiC interaction Proc.Natl.Acad.Sci.USA, 101, 2004
|
|