1TAE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1tae by Molmil](/molmil-images/mine/1tae) | |
4RDX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4rdx by Molmil](/molmil-images/mine/4rdx) | Structure of histidinyl-tRNA synthetase in complex with tRNA(His) | Descriptor: | ADENOSINE MONOPHOSPHATE, HISTIDINE, Histidine--tRNA ligase, ... | Authors: | Xie, W, Tian, Q, Wang, C. | Deposit date: | 2014-09-20 | Release date: | 2015-03-25 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.55 Å) | Cite: | Structural basis for recognition of G-1-containing tRNA by histidyl-tRNA synthetase Nucleic Acids Res., 43, 2015
|
|
4C38
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4c38 by Molmil](/molmil-images/mine/4c38) | PKA-S6K1 Chimera with compound 21e (CCT239066) bound | Descriptor: | 4-(1-ethyl-6-methyl-imidazo[4,5-c]pyridin-2-yl)-1,2,5-oxadiazol-3-amine, CAMP-DEPENDENT PROTEIN KINASE CATALYTIC SUBUNIT ALPHA, CAMP-DEPENDENT PROTEIN KINASE INHIBITOR PEPTIDE, ... | Authors: | Couty, S, Westwood, I.M, Kalusa, A, Cano, C, Travers, J, Boxall, K, Chow, C.L, Burns, S, Schmitt, J, Pickard, L, Barillari, C, McAndrew, P.C, Clarke, P.A, Linardopoulos, S, Griffin, R.J, Aherne, G.W, Raynaud, F.I, Workman, P, Jones, K, van Montfort, R.L.M. | Deposit date: | 2013-08-21 | Release date: | 2013-10-09 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (1.58 Å) | Cite: | The discovery of potent ribosomal S6 kinase inhibitors by high-throughput screening and structure-guided drug design. Oncotarget, 4, 2013
|
|
5UZK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5uzk by Molmil](/molmil-images/mine/5uzk) | Crystal Structure of PKA bound to an pyrrolo pyridine inhibitor | Descriptor: | 2-{3-[3-(piperidin-4-yl)propoxy]phenyl}-N-[4-(1H-pyrrolo[2,3-b]pyridin-3-yl)-1,3-thiazol-2-yl]acetamide, cAMP-dependent protein kinase catalytic subunit alpha, cAMP-dependent protein kinase inhibitor alpha | Authors: | Jacobs, M.D, Brown, K. | Deposit date: | 2017-02-26 | Release date: | 2018-03-07 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | ROCK inhibitors 3: Design, synthesis and structure-activity relationships of 7-azaindole-based Rho kinase (ROCK) inhibitors. Bioorg. Med. Chem. Lett., 28, 2018
|
|
1V8L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1v8l by Molmil](/molmil-images/mine/1v8l) | Structure Analysis of the ADP-ribose pyrophosphatase complexed with ADP-ribose | Descriptor: | ADENOSINE-5-DIPHOSPHORIBOSE, ADP-ribose pyrophosphatase | Authors: | Yoshiba, S, Ooga, T, Nakagawa, N, Shibata, T, Inoue, Y, Yokoyama, S, Kuramitsu, S, Masui, R, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2004-01-10 | Release date: | 2004-10-19 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Structural insights into the Thermus thermophilus ADP-ribose pyrophosphatase mechanism via crystal structures with the bound substrate and metal J.Biol.Chem., 279, 2004
|
|
1V8R
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1v8r by Molmil](/molmil-images/mine/1v8r) | Crystal structure analysis of the ADP-ribose pyrophosphatase complexed with ADP-ribose and Zn | Descriptor: | ADENOSINE-5-DIPHOSPHORIBOSE, ADP-ribose pyrophosphatase, ZINC ION | Authors: | Yoshiba, S, Ooga, T, Nakagawa, N, Shibata, T, Inoue, Y, Yokoyama, S, Kuramitsu, S, Masui, R, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2004-01-14 | Release date: | 2005-02-22 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structural insights into the Thermus thermophilus ADP-ribose pyrophosphatase mechanism via crystal structures with the bound substrate and metal J.Biol.Chem., 279, 2004
|
|
1V8Y
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1v8y by Molmil](/molmil-images/mine/1v8y) | Crystal structure analysis of the ADP-ribose pyrophosphatase of E86Q mutant, complexed with ADP-ribose and Zn | Descriptor: | ADENOSINE-5-DIPHOSPHORIBOSE, ADP-ribose pyrophosphatase, ZINC ION | Authors: | Yoshiba, S, Ooga, T, Nakagawa, N, Shibata, T, Inoue, Y, Yokoyama, S, Kuramitsu, S, Masui, R, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2004-01-15 | Release date: | 2004-10-19 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (1.65 Å) | Cite: | Structural insights into the Thermus thermophilus ADP-ribose pyrophosphatase mechanism via crystal structures with the bound substrate and metal J.Biol.Chem., 279, 2004
|
|
2ZT6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2zt6 by Molmil](/molmil-images/mine/2zt6) | |
4GR5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4gr5 by Molmil](/molmil-images/mine/4gr5) | Crystal structure of SlgN1deltaAsub in complex with AMPcPP | Descriptor: | CHLORIDE ION, DIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER, L(+)-TARTARIC ACID, ... | Authors: | Herbst, D.A, Zocher, G, Stehle, T. | Deposit date: | 2012-08-24 | Release date: | 2012-11-28 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.92 Å) | Cite: | Structural Basis of the Interaction of MbtH-like Proteins, Putative Regulators of Nonribosomal Peptide Biosynthesis, with Adenylating Enzymes. J.Biol.Chem., 288, 2013
|
|
1V8T
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1v8t by Molmil](/molmil-images/mine/1v8t) | Crystal Structure analysis of the ADP-ribose pyrophosphatase complexed with ribose-5'-phosphate and Zn | Descriptor: | ADP-ribose pyrophosphatase, RIBOSE-5-PHOSPHATE, ZINC ION | Authors: | Yoshiba, S, Ooga, T, Nakagawa, N, Shibata, T, Inoue, Y, Yokoyama, S, Kuramitsu, S, Masui, R, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2004-01-14 | Release date: | 2004-10-19 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural insights into the Thermus thermophilus ADP-ribose pyrophosphatase mechanism via crystal structures with the bound substrate and metal J.Biol.Chem., 279, 2004
|
|
1V8N
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1v8n by Molmil](/molmil-images/mine/1v8n) | Crystal structure analysis of the ADP-ribose pyrophosphatase complexed with Zn | Descriptor: | ADP-ribose pyrophosphatase, ZINC ION | Authors: | Yoshiba, S, Ooga, T, Nakagawa, N, Shibata, T, Inoue, Y, Yokoyama, S, Kuramitsu, S, Masui, R, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2004-01-12 | Release date: | 2004-10-19 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (1.74 Å) | Cite: | Structural insights into the Thermus thermophilus ADP-ribose pyrophosphatase mechanism via crystal structures with the bound substrate and metal J.Biol.Chem., 279, 2004
|
|
1V8V
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1v8v by Molmil](/molmil-images/mine/1v8v) | Crystal structure analysis of the ADP-ribose pyrophosphatase of E86Q mutant, complexed with ADP-ribose and Mg | Descriptor: | ADENOSINE-5-DIPHOSPHORIBOSE, ADP-ribose pyrophosphatase, MAGNESIUM ION | Authors: | Yoshiba, S, Ooga, T, Nakagawa, N, Shibata, T, Inoue, Y, Yokoyama, S, Kuramitsu, S, Masui, R, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2004-01-15 | Release date: | 2004-10-19 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (1.97 Å) | Cite: | Structural insights into the Thermus thermophilus ADP-ribose pyrophosphatase mechanism via crystal structures with the bound substrate and metal J.Biol.Chem., 279, 2004
|
|
1V8U
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1v8u by Molmil](/molmil-images/mine/1v8u) | Crystal structure analysis of the ADP-ribose pyrophosphatase of E82Q mutant with SO4 and Mg | Descriptor: | ADP-ribose pyrophosphatase, MAGNESIUM ION, SULFATE ION | Authors: | Yoshiba, S, Ooga, T, Nakagawa, N, Shibata, T, Inoue, Y, Yokoyama, S, Kuramitsu, S, Masui, R, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2004-01-15 | Release date: | 2004-10-19 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Structural insights into the Thermus thermophilus ADP-ribose pyrophosphatase mechanism via crystal structures with the bound substrate and metal J.Biol.Chem., 279, 2004
|
|
1V8M
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1v8m by Molmil](/molmil-images/mine/1v8m) | Crystal structure analysis of ADP-ribose pyrophosphatase complexed with ADP-ribose and Gd | Descriptor: | ADENOSINE-5-DIPHOSPHORIBOSE, ADP-ribose pyrophosphatase, GADOLINIUM ATOM | Authors: | Yoshiba, S, Ooga, T, Nakagawa, N, Shibata, T, Inoue, Y, Yokoyama, S, Kuramitsu, S, Masui, R, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2004-01-12 | Release date: | 2004-10-19 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structural insights into the Thermus thermophilus ADP-ribose pyrophosphatase mechanism via crystal structures with the bound substrate and metal J.Biol.Chem., 279, 2004
|
|
1V8I
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1v8i by Molmil](/molmil-images/mine/1v8i) | Crystal Structure Analysis of the ADP-ribose pyrophosphatase | Descriptor: | ADP-ribose pyrophosphatase | Authors: | Yoshiba, S, Ooga, T, Nakagawa, N, Shibata, T, Inoue, Y, Yokoyama, S, Kuramitsu, S, Masui, R, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2004-01-09 | Release date: | 2004-10-19 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (1.76 Å) | Cite: | Structural insights into the Thermus thermophilus ADP-ribose pyrophosphatase mechanism via crystal structures with the bound substrate and metal J.Biol.Chem., 279, 2004
|
|
1V8W
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1v8w by Molmil](/molmil-images/mine/1v8w) | Crystal structure analysis of the ADP-ribose pyrophosphatase of E82Q mutant, complexed with SO4 and Zn | Descriptor: | ADP-ribose pyrophosphatase, SULFATE ION, ZINC ION | Authors: | Yoshiba, S, Ooga, T, Nakagawa, N, Shibata, T, Inoue, Y, Yokoyama, S, Kuramitsu, S, Masui, R, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2004-01-15 | Release date: | 2004-10-19 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (1.66 Å) | Cite: | Structural insights into the Thermus thermophilus ADP-ribose pyrophosphatase mechanism via crystal structures with the bound substrate and metal J.Biol.Chem., 279, 2004
|
|
4C36
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4c36 by Molmil](/molmil-images/mine/4c36) | PKA-S6K1 Chimera with compound 15e (CCT147581) bound | Descriptor: | 4-[1-(cyclopropylmethyl)-1H-benzimidazol-2-yl]-1,2,5-oxadiazol-3-amine, CAMP-DEPENDENT PROTEIN KINASE CATALYTIC SUBUNIT ALPHA, CAMP-DEPENDENT PROTEIN KINASE INHIBITOR ALPHA, ... | Authors: | Couty, S, Westwood, I.M, Kalusa, A, Cano, C, Travers, J, Boxall, K, Chow, C.L, Burns, S, Schmitt, J, Pickard, L, Barillari, C, McAndrew, P.C, Clarke, P.A, Linardopoulos, S, Griffin, R.J, Aherne, G.W, Raynaud, F.I, Workman, P, Jones, K, van Montfort, R.L.M. | Deposit date: | 2013-08-21 | Release date: | 2013-10-09 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (1.98 Å) | Cite: | The discovery of potent ribosomal S6 kinase inhibitors by high-throughput screening and structure-guided drug design. Oncotarget, 4, 2013
|
|
4C37
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4c37 by Molmil](/molmil-images/mine/4c37) | PKA-S6K1 Chimera with compound 21a (CCT196539) bound | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 4-(6-bromo-1-ethyl-1H-imidazo[4,5-c]pyridin-2-yl)-1,2,5-oxadiazol-3-amine, CAMP-DEPENDENT PROTEIN KINASE CATALYTIC SUBUNIT ALPHA, ... | Authors: | Couty, S, Westwood, I.M, Kalusa, A, Cano, C, Travers, J, Boxall, K, Chow, C.L, Burns, S, Schmitt, J, Pickard, L, Barillari, C, McAndrew, P.C, Clarke, P.A, Linardopoulos, S, Griffin, R.J, Aherne, G.W, Raynaud, F.I, Workman, P, Jones, K, van Montfort, R.L.M. | Deposit date: | 2013-08-21 | Release date: | 2013-10-09 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | The discovery of potent ribosomal S6 kinase inhibitors by high-throughput screening and structure-guided drug design. Oncotarget, 4, 2013
|
|
1TA8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ta8 by Molmil](/molmil-images/mine/1ta8) | |
2XJ0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2xj0 by Molmil](/molmil-images/mine/2xj0) | Protein kinase Pim-1 in complex with fragment-4 from crystallographic fragment screen | Descriptor: | (E)-3-(2-AMINO-PYRIDINE-5YL)-ACRYLIC ACID, PROTO-ONCOGENE SERINE/THREONINE PROTEIN KINASE PIM-1 | Authors: | Schulz, M.N, Fanghanel, J, Schafer, M, Badock, V, Briem, H, Boemer, U, Nguyen, D, Husemann, M, Hillig, R.C. | Deposit date: | 2010-07-01 | Release date: | 2011-02-23 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Crystallographic Fragment Screen Identifies Cinnamic Acid Derivatives as Starting Points for Potent Pim-1 Inhibitors Acta Crystallogr.,Sect.D, 67, 2011
|
|
2XIZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2xiz by Molmil](/molmil-images/mine/2xiz) | Protein kinase Pim-1 in complex with fragment-3 from crystallographic fragment screen | Descriptor: | (E)-PYRIDIN-4-YL-ACRYLIC ACID, PROTO-ONCOGENE SERINE/THREONINE PROTEIN KINASE PIM-1 | Authors: | Schulz, M.N, Fanghanel, J, Schafer, M, Badock, V, Briem, H, Boemer, U, Nguyen, D, Husemann, M, Hillig, R.C. | Deposit date: | 2010-07-01 | Release date: | 2011-02-23 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (2.21 Å) | Cite: | Crystallographic Fragment Screen Identifies Cinnamic Acid Derivatives as Starting Points for Potent Pim-1 Inhibitors Acta Crystallogr.,Sect.D, 67, 2011
|
|
2XJ1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2xj1 by Molmil](/molmil-images/mine/2xj1) | Protein kinase Pim-1 in complex with small molecule inibitor | Descriptor: | (2E)-3-(3-{6-[(TRANS-4-AMINOCYCLOHEXYL)AMINO]PYRAZIN-2-YL}PHENYL)PROP-2-ENOIC ACID, PROTO-ONCOGENE SERINE/THREONINE-PROTEIN KINASE PIM-1 | Authors: | Schulz, M.N, Fanghanel, J, Schafer, M, Badock, V, Briem, H, Boemer, U, Nguyen, D, Husemann, M, Hillig, R.C. | Deposit date: | 2010-07-01 | Release date: | 2011-02-23 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (2.13 Å) | Cite: | Crystallographic Fragment Screen Identifies Cinnamic Acid Derivatives as Starting Points for Potent Pim-1 Inhibitors Acta Crystallogr.,Sect.D, 67, 2011
|
|
4ZCF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4zcf by Molmil](/molmil-images/mine/4zcf) | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I | Descriptor: | ADENOSINE MONOPHOSPHATE, CALCIUM ION, DNA 20-mer AATCATAGTCTACTGCTGTA, ... | Authors: | Gupta, Y.K, Chan, S.H, Xu, S.Y, Aggarwal, A.K. | Deposit date: | 2015-04-15 | Release date: | 2015-07-29 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I. Nat Commun, 6, 2015
|
|
7PQK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7pqk by Molmil](/molmil-images/mine/7pqk) | |
5KF4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5kf4 by Molmil](/molmil-images/mine/5kf4) | |