1JO2
 
 | |
2IUJ
 | | Crystal Structure of Soybean Lipoxygenase-B | | Descriptor: | FE (III) ION, LIPOXYGENASE L-5 | | Authors: | Youn, B, Sellhorn, G.E, Mirchel, R.J, Gaffney, B.J, Grimes, H.D, Kang, C. | | Deposit date: | 2006-06-05 | | Release date: | 2006-10-11 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Crystal Structures of Vegetative Soybean Lipoxygenase Vlx-B and Vlx-D, and Comparisons with Seed Isoforms Lox-1 and Lox-3.
Proteins, 65, 2006
|
|
3GPB
 | |
3ZXZ
 | | X-ray Structure of PF-04217903 bound to the kinase domain of c-Met | | Descriptor: | 2-{4-[1-(QUINOLIN-6-YLMETHYL)-1H-[1,2,3]TRIAZOLO[4,5-B]PYRAZIN-6-YL]-1H-PYRAZOL-1-YL}ETHANOL, HEPATOCYTE GROWTH FACTOR RECEPTOR | | Authors: | McTigue, M, Grodsky, N, Ryan, K, Cui, J.J. | | Deposit date: | 2011-08-16 | | Release date: | 2011-08-31 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Discovery of a Novel Class of Exquisitely Selective Mesenchymal-Epithelial Transition Factor (C-met) Protein Kinase Inhibitors and Identification of the Clinical Candidate 2-(4-(1-(Quinolin-6-Ylmethyl)-1H-[1,2, 3]Triazolo[4,5-B]Pyrazin-6-Yl)-1H-Pyrazol-1-Yl)Ethanol (Pf-04217903) for the Treatment of Cancer.
J.Med.Chem., 55, 2012
|
|
2R76
 | | Crystal structure of the rare lipoprotein B (SO_1173) from Shewanella oneidensis, Northeast Structural Genomics Consortium Target SoR91A | | Descriptor: | Rare lipoprotein B | | Authors: | Forouhar, F, Chen, Y, Seetharaman, J, Mao, L, Maglaqui, M, Owen, L.A, Cunningham, K, Fang, Y, Xiao, R, Baran, M.C, Acton, T.B, Montelione, G.T, Hunt, J.F, Tong, L, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2007-09-07 | | Release date: | 2007-09-25 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal structure of the rare lipoprotein B (SO_1173) from Shewanella oneidensis.
To be Published
|
|
6E7D
 | | Structure of the inhibitory NKR-P1B receptor bound to the host-encoded ligand, Clr-b | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, C-type lectin domain family 2 member D, Killer cell lectin-like receptor subfamily B member 1B allele B, ... | | Authors: | Balaji, G.R, Rossjohn, J, Berry, R. | | Deposit date: | 2018-07-26 | | Release date: | 2018-10-24 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Recognition of host Clr-b by the inhibitory NKR-P1B receptor provides a basis for missing-self recognition.
Nat Commun, 9, 2018
|
|
4BYI
 | | Aurora A kinase bound to a highly selective imidazopyridine inhibitor | | Descriptor: | (S)-N-((1-(6-chloro-2-(1,3-dimethyl-1H-pyrazol-4-yl)-3H-imidazo[4,5-b]pyridin-7-yl)pyrrolidin-3-yl)methyl)acetamide, AURORA KINASE A | | Authors: | Joshi, A, Kosmopoulou, M, Bayliss, R. | | Deposit date: | 2013-07-19 | | Release date: | 2013-11-20 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Aurora Isoform Selectivity: Design and Synthesis of Imidazo[4,5-B]Pyridine Derivatives as Highly Selective Inhibitors of Aurora-A Kinase in Cells.
J.Med.Chem., 56, 2013
|
|
4BYJ
 | | Aurora A kinase bound to a highly selective imidazopyridine inhibitor | | Descriptor: | (S)-N-(1-(6-chloro-2-(1,3-dimethyl-1H-pyrazol-4-yl)-3H-imidazo[4,5-b]pyridin-7-yl)pyrrolidin-3-yl)acetamide, AURORA KINASE A | | Authors: | Joshi, A, Kosmopoulou, M, Bayliss, R. | | Deposit date: | 2013-07-19 | | Release date: | 2013-11-20 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.75 Å) | | Cite: | Aurora Isoform Selectivity: Design and Synthesis of Imidazo[4,5-B]Pyridine Derivatives as Highly Selective Inhibitors of Aurora-A Kinase in Cells.
J.Med.Chem., 56, 2013
|
|
3ZDI
 | | Glycogen Synthase Kinase 3 Beta complexed with Axin Peptide and Inhibitor 7d | | Descriptor: | 3,6-Diamino-4-(2-chlorophenyl)thieno[2,3-b]pyridine-2,5-dicarbonitrile, AXIN-1, GLYCOGEN SYNTHASE KINASE-3 BETA, ... | | Authors: | Oberholzer, A.E, Pearl, L.H. | | Deposit date: | 2012-11-27 | | Release date: | 2012-12-26 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (2.645 Å) | | Cite: | 3,6-Diamino-4-(2-Halophenyl)-2-Benzoylthieno(2,3-B) Pyridine-5-Carbonitriles are Selective Inhibitors of Plasmodium Falciparum Glycogen Synthase Kinase-3 (Pfgsk-3)
J.Med.Chem., 56, 2013
|
|
4HFX
 | | Crystal structure of a transcription elongation factor B polypeptide 3 from Homo sapiens, Northeast Structural Genomics consortium target id HR4748B. | | Descriptor: | SULFATE ION, Transcription elongation factor B polypeptide 3 | | Authors: | Seetharaman, J, Su, M, Ciccosanti, C, Sahdev, S, Acton, T.B, Xiao, R, Everett, J.K, Montelione, G.T, Hunt, J.F, Tong, L, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2012-10-05 | | Release date: | 2012-12-12 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.54 Å) | | Cite: | Crystal structure of a transcription elongation factor B polypeptide 3 from Homo sapiens, Northeast Structural Genomics consortium target id HR4748B. (CASP Target)
TO BE PUBLISHED
|
|
5CT7
 | | BRAF in Complex with RAF265 | | Descriptor: | 1-methyl-5-({2-[5-(trifluoromethyl)-1H-imidazol-2-yl]pyridin-4-yl}oxy)-N-[4-(trifluoromethyl)phenyl]-1H-benzimidazol-2-amine, Serine/threonine-protein kinase B-raf | | Authors: | Appleton, B.A. | | Deposit date: | 2015-07-23 | | Release date: | 2015-09-09 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (3.17 Å) | | Cite: | Discovery of RAF265: A Potent mut-B-RAF Inhibitor for the Treatment of Metastatic Melanoma.
Acs Med.Chem.Lett., 6, 2015
|
|
1DMQ
 | | CRYSTAL STRUCTURE OF MUTANT ENZYME Y32F OF KETOSTEROID ISOMERASE FROM PSEUDOMONAS PUTIDA BIOTYPE B | | Descriptor: | STEROID DELTA-ISOMERASE | | Authors: | Kim, D.H, Jang, D.S, Nam, G.H, Oh, B.H, Choi, K.Y. | | Deposit date: | 1999-12-14 | | Release date: | 2000-05-23 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Contribution of the hydrogen-bond network involving a tyrosine triad in the active site to the structure and function of a highly proficient ketosteroid isomerase from Pseudomonas putida biotype B.
Biochemistry, 39, 2000
|
|
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1R7W
 | | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
2JC3
 | | Structure of O-Acetylserine Sulfhydrylase B from Salmonella Typhimurium | | Descriptor: | O-ACETYLSERINE SULFHYDRYLASE B, PYRIDOXAL-5'-PHOSPHATE | | Authors: | Chattopadhyay, A, Rabeh, W.M, Speroni, F, Meier, M, Ivaninskii, S, Mozzarelli, A, Burkhard, P, Cook, P.F. | | Deposit date: | 2006-12-19 | | Release date: | 2007-01-23 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structure, Mechanism, and Conformational Dynamics of O-Acetylserine Sulfhydrylase from Salmonella Typhimurium: Comparison of a and B Isozymes.
Biochemistry, 46, 2007
|
|
4O4X
 | | Crystal structure of the vaccine antigen Transferrin Binding Protein B (TbpB) double mutant Tyr-167-Ala and Trp-176-Ala from Haemophilus parasuis Hp5 | | Descriptor: | GLYCEROL, SODIUM ION, SULFATE ION, ... | | Authors: | Calmettes, C, Yu, R.H, Schryvers, A.B, Moraes, T.F. | | Deposit date: | 2013-12-19 | | Release date: | 2015-01-14 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Nonbinding site-directed mutants of transferrin binding protein B exhibit enhanced immunogenicity and protective capabilities.
Infect.Immun., 83, 2015
|
|
1XHA
 | | Crystal Structures of Protein Kinase B Selective Inhibitors in Complex with Protein Kinase A and Mutants | | Descriptor: | N-{4-[(4-{3-[(2R)-3,3-DIMETHYLPIPERIDIN-2-YL]-2-FLUORO-6-HYDROXYBENZOYL}BENZOYL)AMINO]AZEPAN-3-YL}ISONICOTINAMIDE, cAMP-dependent protein kinase inhibitor, alpha form, ... | | Authors: | Breitenlechner, C.B, Friebe, W.-G, Brunet, E, Werner, G, Graul, K, Thomas, U, Kuenkele, K.-P, Schaefer, W, Gassel, M, Bossemeyer, D, Huber, R, Engh, R.A, Masjost, B. | | Deposit date: | 2004-09-17 | | Release date: | 2005-09-17 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (2.46 Å) | | Cite: | Design and crystal structures of protein kinase B-selective inhibitors in complex with protein kinase A and mutants
J.Med.Chem., 48, 2005
|
|
4RX6
 | | Structure of B. subtilis GlnK-ATP complex to 2.6 Angstrom | | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, Nitrogen regulatory PII-like protein | | Authors: | Schumacher, M.A, Cuthbert, B, Tonthat, N, Chinnam, N.G, Whitfill, T. | | Deposit date: | 2014-12-09 | | Release date: | 2015-12-30 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.5994 Å) | | Cite: | Structures of regulatory machinery reveal novel molecular mechanisms controlling B. subtilis nitrogen homeostasis.
Genes Dev., 29, 2015
|
|
5D7D
 | | Crystal structure of the ATP binding domain of S. aureus GyrB complexed with a ligand | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 7-propyl-3-[2-(pyridin-3-yl)-1,3-thiazol-5-yl]-1,7-dihydro-6H-pyrazolo[3,4-b]pyridin-6-one, CHLORIDE ION, ... | | Authors: | Zhang, J, Yang, Q, Cross, J.B, Romero, J.A.C, Ryan, M.D, Lippa, B, Dolle, R.E, Andersen, O.A, Barker, J, Cheng, R.K, Kahmann, J, Felicetti, B, Wood, M, Scheich, C. | | Deposit date: | 2015-08-13 | | Release date: | 2015-11-11 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Discovery of Indazole Derivatives as a Novel Class of Bacterial Gyrase B Inhibitors.
Acs Med.Chem.Lett., 6, 2015
|
|
6I5H
 | | Crystal structure of CLK1 in complex with furanopyrimidin VN412 | | Descriptor: | 1,2-ETHANEDIOL, 5-(1-methylpyrazol-4-yl)-3-(3-phenoxyphenyl)furo[3,2-b]pyridine, Dual specificity protein kinase CLK1, ... | | Authors: | Schroeder, M, Arrowsmith, C.H, Edwards, A.M, Bountra, C, Paruch, K, Knapp, S, Structural Genomics Consortium (SGC) | | Deposit date: | 2018-11-13 | | Release date: | 2019-01-16 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.49 Å) | | Cite: | Furo[3,2-b]pyridine: A Privileged Scaffold for Highly Selective Kinase Inhibitors and Effective Modulators of the Hedgehog Pathway.
Angew. Chem. Int. Ed. Engl., 58, 2019
|
|
1XH4
 | | Crystal Structures of Protein Kinase B Selective Inhibitors in Complex with Protein Kinase A and Mutants | | Descriptor: | N-[4-({4-[5-(DIMETHYLAMINO)-2-HYDROXYBENZOYL]BENZOYL}AMINO)AZEPAN-3-YL]ISONICOTINAMIDE, cAMP-dependent protein kinase inhibitor, alpha form, ... | | Authors: | Breitenlechner, C.B, Friebe, W.-G, Brunet, E, Werner, G, Graul, K, Thomas, U, Kuenkele, K.-P, Schaefer, W, Gassel, M, Bossemeyer, D, Huber, R, Engh, R.A, Masjost, B. | | Deposit date: | 2004-09-17 | | Release date: | 2005-09-17 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Design and crystal structures of protein kinase B-selective inhibitors in complex with protein kinase A and mutants
J.Med.Chem., 48, 2005
|
|
1K08
 | | Crystallographic Binding Study of 10 mM N-benzoyl-N'-beta-D-glucopyranosyl urea to glycogen phosphorylase b | | Descriptor: | Glycogen Phosphorylase, N-[(phenylcarbonyl)carbamoyl]-beta-D-glucopyranosylamine, PYRIDOXAL-5'-PHOSPHATE | | Authors: | Oikonomakos, N.G, Kosmopoulou, M, Zographos, S.E, Leonidas, D.D, Chrysina, E.D, Somsak, L, Nagy, V, Praly, J.P, Docsa, T, Toth, B, Gergely, P. | | Deposit date: | 2001-09-18 | | Release date: | 2001-10-03 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.26 Å) | | Cite: | Binding of N-acetyl-N '-beta-D-glucopyranosyl urea and N-benzoyl-N '-beta-D-glucopyranosyl urea to glycogen phosphorylase b: kinetic and crystallographic studies.
Eur.J.Biochem., 269, 2002
|
|
1XH8
 | | Crystal Structures of Protein Kinase B Selective Inhibitors in Complex with Protein Kinase A and Mutants | | Descriptor: | N-[4-({4-[5-(4,4-DIMETHYLPIPERIDIN-1-YL)-2-HYDROXYBENZOYL]BENZOYL}AMINO)AZEPAN-3-YL]ISONICOTINAMIDE, cAMP-dependent protein kinase inhibitor, alpha form, ... | | Authors: | Breitenlechner, C.B, Friebe, W.-G, Brunet, E, Werner, G, Graul, K, Thomas, U, Kuenkele, K.-P, Schaefer, W, Gassel, M, Bossemeyer, D, Huber, R, Engh, R.A, Masjost, B. | | Deposit date: | 2004-09-17 | | Release date: | 2005-09-17 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Design and crystal structures of protein kinase B-selective inhibitors in complex with protein kinase A and mutants
J.Med.Chem., 48, 2005
|
|
1DMM
 | | CRYSTAL STRUCTURES OF MUTANT ENZYMES Y57F OF KETOSTEROID ISOMERASE FROM PSEUDOMONAS PUTIDA BIOTYPE B | | Descriptor: | STEROID DELTA-ISOMERASE | | Authors: | Kim, D.H, Jang, D.S, Nam, G.H, Oh, B.H, Choi, K.Y. | | Deposit date: | 1999-12-14 | | Release date: | 2000-05-23 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Contribution of the hydrogen-bond network involving a tyrosine triad in the active site to the structure and function of a highly proficient ketosteroid isomerase from Pseudomonas putida biotype B.
Biochemistry, 39, 2000
|
|
1XH6
 | | Crystal Structures of Protein Kinase B Selective Inhibitors in Complex with Protein Kinase A and Mutants | | Descriptor: | N-(4-{[4-(2-HYDROXY-5-PIPERIDIN-1-YLBENZOYL)BENZOYL]AMINO}AZEPAN-3-YL)ISONICOTINAMIDE, cAMP-dependent protein kinase inhibitor, alpha form, ... | | Authors: | Breitenlechner, C.B, Friebe, W.-G, Brunet, E, Werner, G, Graul, K, Thomas, U, Kuenkele, K.-P, Schaefer, W, Gassel, M, Bossemeyer, D, Huber, R, Engh, R.A, Masjost, B. | | Deposit date: | 2004-09-17 | | Release date: | 2005-09-17 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Design and crystal structures of protein kinase B-selective inhibitors in complex with protein kinase A and mutants
J.Med.Chem., 48, 2005
|
|
