PDB: 45953 resultsInfo pagesStatus searchChemie searchBIRD

---

5B81	Solution NMR structure of a 16-mer DNA duplex containing quadruple GC mismatches showing staggered base pairing, and consequent rescue of canonical double helical characteristics Descriptor: DNA (5'-D(*CP*GP*CP*GP*TP*AP*CP*GP*CP*GP*AP*TP*GP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*GP*CP*AP*TP*GP*CP*GP*CP*TP*AP*CP*GP*CP*G)-3') Authors: De, M, Chatterjee, S. Deposit date: 2016-06-11 Release date: 2016-06-29 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Solution NMR structure of a 16-mer DNA duplex containing quadruple GC mismatches showing staggered base pairing, and consequent rescue of canonical double helical characteristics To Be Published
7B71	Single modified phosphoryl guanidine DNA duplex, Sp diastereomer Descriptor: DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*(SGT)P*G)-3') Authors: Lomzov, A.A, Shernuykov, A.V, Apukhtina, V.S, Pyshnyi, D.V. Deposit date: 2020-12-09 Release date: 2021-01-13 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Single modified phosphoryl guanidine DNA duplex, Sp diastereomer To Be Published
7VP1	Structure of a transcription factor and DNA complex Descriptor: DNA (5'-D(*AP*TP*GP*TP*GP*GP*TP*CP*CP*CP*CP*C)-3'), DNA (5'-D(*TP*GP*GP*GP*GP*GP*AP*CP*CP*AP*CP*A)-3'), Transcription factor TCP10 Authors: Zhang, Y, Xu, Y.P, Wang, B, Su, X.D. Deposit date: 2021-10-15 Release date: 2022-10-19 Method: X-RAY DIFFRACTION (2.902 Å) Cite: Structural basis for DNA recognition by TCP transcription factors To Be Published
7VP3	Structure of a transcription factor and DNA complex Descriptor: DNA (5'-D(*AP*TP*GP*TP*GP*GP*GP*TP*CP*CP*CP*C)-3'), DNA (5'-D(*TP*GP*GP*GP*GP*AP*CP*CP*CP*AP*C)-3'), Transcription factor TCP15 Authors: Zhang, Y, Xu, Y.P, Wang, B, Su, X.D. Deposit date: 2021-10-15 Release date: 2022-10-19 Last modified: 2023-11-29 Method: X-RAY DIFFRACTION (3.003 Å) Cite: Structural basis for DNA recognition by TCP transcription factors To Be Published
3ULD	High resolution structure of DNA/RNA hybrid in complex with RNase H catalytic domain D132N mutant Descriptor: DNA (5'-D(*AP*TP*GP*TP*CP*(PGN))-3'), MAGNESIUM ION, RNA (5'-R(*UP*CP*GP*AP*CP*A)-3'), ... Authors: Gan, J.H, Abdur, R, Huang, Z. Deposit date: 2011-11-10 Release date: 2012-11-14 Last modified: 2023-09-13 Method: X-RAY DIFFRACTION (1.6 Å) Cite: RNA/DNA hybrid in complex with RNase H catalytic domain mutant D132N To be Published
3UKB	(R)-cEt-BNA decamer structure Descriptor: DNA (5'-D(*GP*CP*GP*TP*AP*(RCE)P*AP*CP*GP*C)-3') Authors: Pallan, P.S, Egli, M. Deposit date: 2011-11-09 Release date: 2012-06-20 Last modified: 2023-09-13 Method: X-RAY DIFFRACTION (1.42 Å) Cite: Structure and nuclease resistance of 2',4'-constrained 2'-O-methoxyethyl (cMOE) and 2'-O-ethyl (cEt) modified DNAs. Chem.Commun.(Camb.), 48, 2012
1VPK	Crystal structure of DNA polymerase III, beta subunit (TM0262) from Thermotoga maritima at 2.00 A resolution Descriptor: DNA polymerase III, beta subunit Authors: Joint Center for Structural Genomics (JCSG) Deposit date: 2004-11-09 Release date: 2004-11-23 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2 Å) Cite: Crystal structure of DNA polymerase III, beta subunit (TM0262) from Thermotoga maritima at 2.00 A resolution To be published
2M2E	Solution NMR structure of the SANT domain of human DNAJC2, Northeast structural genomics consortium target HR8254a Descriptor: DnaJ homolog subfamily C member 2 Authors: Lemak, A, Yee, A, Houliston, S, Garcia, M, Ong, M, Montelione, G.T, Arrowsmith, C, Northeast Structural Genomics Consortium (NESG), Structural Genomics Consortium (SGC) Deposit date: 2012-12-18 Release date: 2013-02-20 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: NMR solution structure of the SANT domain of human DnaJC2. To be Published
5CKK	Crystal structure of 9DB1* deoxyribozyme Descriptor: DNA (44-MER), MAGNESIUM ION, RNA (5'-R(P*GP*CP*AP*CP*UP*AP*GP*AP*UP*CP*GP*GP*AP*UP*G)-3') Authors: Ponce-Salvatierra, A, Hoebartner, C, Pena, V. Deposit date: 2015-07-15 Release date: 2016-01-13 Last modified: 2024-01-10 Method: X-RAY DIFFRACTION (2.801 Å) Cite: Crystal structure of a DNA catalyst. Nature, 529, 2016
8CS0	Crystal structure of alien DNA CTSZZPBSBSZPPBAG in a host-guest complex with the N-terminal fragment of Moloney murine leukemia virus reverse transcriptase Descriptor: DNA (5'-D(*CP*TP*(JSP)P*(1W5)P*(1W5)P*(1WA)P*(IGU)P*(JSP))-3'), DNA (5'-D(P*(IGU)P*(JSP)P*(1W5)P*(1WA)P*(1WA)P*(IGU)P*AP*G)-3'), reverse transcriptase Authors: Georgiadis, M.M. Deposit date: 2022-05-12 Release date: 2023-05-17 Last modified: 2023-10-25 Method: X-RAY DIFFRACTION (1.65 Å) Cite: Alien DNA visualized at high resolution in A- and B-forms To Be Published
2VA8	DNA Repair Helicase Hel308 Descriptor: SKI2-TYPE HELICASE, SULFATE ION Authors: Johnson, K.A, Richards, J, Liu, H, McMahon, S, Oke, M, Carter, L, Naismith, J.H, White, M.F. Deposit date: 2007-08-30 Release date: 2008-01-15 Last modified: 2024-05-01 Method: X-RAY DIFFRACTION (2.3 Å) Cite: Structure of the DNA Repair Helicase Hel308 Reveals DNA Binding and Autoinhibitory Domains. J.Biol.Chem., 283, 2008
5ZTJ	Crystal Structure of GyraseA C-Terminal Domain from Salmonella typhi at 2.4A Resolution Descriptor: DNA gyrase subunit A Authors: Sachdeva, E, Gupta, D, Tiwari, P, Kaur, G, Sharma, S, Singh, T.P, Ethayathulla, A.S, Kaur, P. Deposit date: 2018-05-03 Release date: 2019-05-15 Last modified: 2023-11-22 Method: X-RAY DIFFRACTION (2.4 Å) Cite: The pivot point arginines identified in the beta-pinwheel structure of C-terminal domain from Salmonella Typhi DNA Gyrase A subunit. Sci Rep, 10, 2020
6A28	Crystal structure of PprA W183R mutant form 2 Descriptor: DNA repair protein PprA, SULFATE ION Authors: Adachi, M, Shibazaki, C, Shimizu, R, Arai, S, Satoh, K, Narumi, I, Kuroki, R. Deposit date: 2018-06-09 Release date: 2018-12-26 Last modified: 2023-11-22 Method: X-RAY DIFFRACTION (2.193 Å) Cite: Extended structure of pleiotropic DNA repair-promoting protein PprA from Deinococcus radiodurans. FASEB J., 33, 2019
1VT8	Crystal structure of D(GGGCGCCC)-hexagonal form Descriptor: DNA (5'-D(*GP*GP*GP*CP*GP*CP*CP*C)-3') Authors: Shakked, Z, Guerstein-Guzikevich, G, Eisenstein, M, Frolow, F, Rabinovich, D. Deposit date: 1996-12-02 Release date: 2011-07-13 Last modified: 2023-12-27 Method: X-RAY DIFFRACTION (1.9 Å) Cite: The conformation of the DNA double helix in the crystal is dependent on its environment. Nature, 342, 1989
1NG9	E.coli MutS R697A: an ATPase-asymmetry mutant Descriptor: 5'-D(*AP*GP*CP*TP*GP*CP*CP*AP*GP*GP*CP*AP*CP*CP*AP*GP*TP*GP*TP*CP*AP*GP*CP*GP*TP*CP*CP*TP*AP*T)-3', 5'-D(*AP*TP*AP*GP*GP*AP*CP*GP*CP*TP*GP*AP*CP*AP*CP*TP*GP*GP*TP*GP*CP*TP*TP*GP*GP*CP*AP*GP*CP*T)-3', ADENOSINE-5'-DIPHOSPHATE, ... Authors: Lamers, M.H, Winterwerp, H.H.K, Sixma, T.K. Deposit date: 2002-12-17 Release date: 2003-02-11 Last modified: 2023-08-16 Method: X-RAY DIFFRACTION (2.6 Å) Cite: The alternating ATPase domains of MutS control DNA mismatch repair Embo J., 22, 2003
4QFQ	Crystal structure of natvie Npu DnaE split intein Descriptor: DNA polymerase III, alpha subunit, Nucleic acid binding, ... Authors: Lee, Y.Z, Kuo, J.H, Sue, S.C. Deposit date: 2014-05-21 Release date: 2015-05-27 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (2.035 Å) Cite: Crystal structure of natvie Npu DnaE split intein TO BE PUBLISHED
2V1U	STRUCTURE OF THE AEROPYRUM PERNIX ORC1 PROTEIN IN COMPLEX WITH DNA Descriptor: 5'-D(*AP*CP*CP*CP*CP*TP*CP*CP*GP*TP *TP*TP*CP*CP*TP*GP*TP*GP*GP*AP*GP*A)-3', 5'-D(*TP*CP*TP*CP*CP*AP*CP*AP*GP*GP *AP*AP*AP*CP*GP*GP*AP*GP*GP*GP*GP*T)-3', ADENOSINE-5'-DIPHOSPHATE, ... Authors: Gaudier, M, Schuwirth, B.S, Westcott, S.L, Wigley, D.B. Deposit date: 2007-05-30 Release date: 2007-09-18 Last modified: 2024-05-08 Method: X-RAY DIFFRACTION (3.1 Å) Cite: Structural Basis of DNA Replication Origin Recognition by an Orc Protein. Science, 317, 2007
1XF2	Structure of Fab DNA-1 complexed with dT3 Descriptor: 5'-D(*TP*TP*T)-3', SULFATE ION, antibody heavy chain Fab, ... Authors: Schuermann, J.P, Prewitt, S.P, Deutscher, S.L, Tanner, J.J. Deposit date: 2004-09-13 Release date: 2005-04-12 Last modified: 2023-08-23 Method: X-RAY DIFFRACTION (2.3 Å) Cite: Evidence for Structural Plasticity of Heavy Chain Complementarity-determining Region 3 in Antibody-ssDNA Recognition J.Mol.Biol., 347, 2005
1B22	RAD51 (N-TERMINAL DOMAIN) Descriptor: DNA REPAIR PROTEIN RAD51 Authors: Aihara, H, Ito, Y, Kurumizaka, H, Yokoyama, S, Shibata, T, RIKEN Structural Genomics/Proteomics Initiative (RSGI) Deposit date: 1998-12-04 Release date: 1999-12-03 Last modified: 2023-12-27 Method: SOLUTION NMR Cite: The N-terminal domain of the human Rad51 protein binds DNA: structure and a DNA binding surface as revealed by NMR. J.Mol.Biol., 290, 1999
251D	SINGLE CRYSTAL AND MOLECULAR STRUCTURE OF D(CTCGAG) Descriptor: DNA (5'-D(*CP*TP*CP*GP*AP*G)-3') Authors: Wahl, M.C, Rao, S.T, Sundaralingam, M. Deposit date: 1996-03-01 Release date: 1996-06-27 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Crystal structure of the B-DNA hexamer d(CTCGAG): model for an A-to-B transition. Biophys.J., 70, 1996
6ABO	human XRCC4 and IFFO1 complex Descriptor: DNA repair protein XRCC4, GLYCEROL, Intermediate filament family orphan 1, ... Authors: Li, J, Liu, L, Liang, H, Liu, Y, Xu, D. Deposit date: 2018-07-23 Release date: 2019-07-31 Last modified: 2023-11-22 Method: X-RAY DIFFRACTION (2.65 Å) Cite: The nucleoskeleton protein IFFO1 immobilizes broken DNA and suppresses chromosome translocation during tumorigenesis. Nat.Cell Biol., 21, 2019
1XF3	Structure of ligand-free Fab DNA-1 in space group P65 Descriptor: Fab Light chain, Fab heavy chain Authors: Schuermann, J.P, Prewitt, S.P, Deutscher, S.L, Tanner, J.J. Deposit date: 2004-09-13 Release date: 2005-04-12 Last modified: 2023-08-23 Method: X-RAY DIFFRACTION (2.3 Å) Cite: Evidence for Structural Plasticity of Heavy Chain Complementarity-determining Region 3 in Antibody-ssDNA Recognition J.Mol.Biol., 347, 2005
7KWL	Deoxyuridine in DNA Structure: Solution Structure of [d(CGUGAATTCGCG)]2 Descriptor: DNA (5'-D(*(DCZ)P*GP*UP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3') Authors: Meints, G.A, Ljunggren, K.D. Deposit date: 2020-12-01 Release date: 2021-12-15 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Single Base Lesions and Mismatches Alter the Backbone Dynamics and Conformational Properties in DNA To Be Published
5J05	DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium Descriptor: DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3') Authors: Dvorkin, S.A, Karsisiotis, A.I, Webba da Silva, M. Deposit date: 2016-03-27 Release date: 2017-04-05 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Encoding canonical DNA quadruplex structure. Sci Adv, 4, 2018
1XF4	Structure of ligand-free Fab DNA-1 in space group P321 solved from crystals with perfect hemihedral twinning Descriptor: Fab heavy chain, Fab light chain, SULFATE ION Authors: Schuermann, J.P, Prewitt, S.P, Deutscher, S.L, Tanner, J.J. Deposit date: 2004-09-13 Release date: 2005-04-12 Last modified: 2023-08-23 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Evidence for Structural Plasticity of Heavy Chain Complementarity-determining Region 3 in Antibody-ssDNA Recognition J.Mol.Biol., 347, 2005

<240241242243244245246247248249250251252253254255>