5J05
DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium
Summary for 5J05
Entry DOI | 10.2210/pdb5j05/pdb |
NMR Information | BMRB: 30045 |
Descriptor | DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3') (1 entity in total) |
Functional Keywords | quadruplex (-ld+l) topology, structure from molmol, dna |
Biological source | synthetic construct |
Total number of polymer chains | 1 |
Total formula weight | 6348.07 |
Authors | Dvorkin, S.A.,Karsisiotis, A.I.,Webba da Silva, M. (deposition date: 2016-03-27, release date: 2017-04-05, Last modification date: 2019-10-23) |
Primary citation | Dvorkin, S.A.,Karsisiotis, A.I.,Webba da Silva, M. Encoding canonical DNA quadruplex structure. Sci Adv, 4:eaat3007-eaat3007, 2018 Cited by PubMed: 30182059DOI: 10.1126/sciadv.aat3007 PDB entries with the same primary citation |
Experimental method | SOLUTION NMR |
Structure validation
Download full validation report