5J05
DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A (A) | DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3') | polymer | 20 | 6348.1 | 1 | synthetic construct |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 1 |
| Total formula weight | 6348.1 | |
| All* | Total formula weight | 6348.1 |






