5J05

DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium

Entity

Entity ID	Chain ID	Description	Type	Chain length	Formula weight	Number of molecules	DB Name (Accession)	Biological source	Descriptive keywords
1	A	DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3')	polymer	20	6348.1	1		synthetic construct

Contents of the asymmetric unit

Polymers	Number of chains	1
	Total formula weight	6348.1
All*	Total formula weight	6348.1

*Water molecules are not included.