7BU5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7bu5 by Molmil](/molmil-images/mine/7bu5) | Crystal Structure of Human SLX4 and MUS81 | Descriptor: | GLYCINE, MUS81 endonuclease homolog (Yeast), isoform CRA_b, ... | Authors: | Wan, B, Wu, J, Lei, M. | Deposit date: | 2020-04-04 | Release date: | 2021-04-07 | Last modified: | 2024-03-27 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | SLX4 control MUS81 endonuclease function in telomere through an intermolecular SAP domain To be published
|
|
9F9M
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 9f9m by Molmil](/molmil-images/mine/9f9m) | Crystal structure of MUS81-EME1 bound by compound 21. | Descriptor: | 5-oxidanyl-4-oxidanylidene-1-(4-piperazin-1-ylphenyl)pyridine-3-carboxylic acid, Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, ... | Authors: | Collie, G.W. | Deposit date: | 2024-05-08 | Release date: | 2024-06-19 | Method: | X-RAY DIFFRACTION (2.469 Å) | Cite: | Fragment-Based Discovery of Novel MUS81 Inhibitors Acs Med.Chem.Lett., 2024
|
|
4P0P
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4p0p by Molmil](/molmil-images/mine/4p0p) | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
9F99
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 9f99 by Molmil](/molmil-images/mine/9f99) | Crystal structure of MUS81-EME1 bound by compound 10. | Descriptor: | 2-(4-chlorophenyl)-5-oxidanyl-6-oxidanylidene-1H-pyrimidine-4-carboxylic acid, Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, ... | Authors: | Collie, G.W. | Deposit date: | 2024-05-07 | Release date: | 2024-06-19 | Method: | X-RAY DIFFRACTION (2.803 Å) | Cite: | Fragment-Based Discovery of Novel MUS81 Inhibitors Acs Med.Chem.Lett., 2024
|
|
4P0Q
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4p0q by Molmil](/molmil-images/mine/4p0q) | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.851 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
9F9A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 9f9a by Molmil](/molmil-images/mine/9f9a) | Crystal structure of MUS81-EME1 bound by compound 12. | Descriptor: | 2-naphthalen-2-yl-5-oxidanyl-6-oxidanylidene-1H-pyrimidine-4-carboxylic acid, Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, ... | Authors: | Collie, G.W. | Deposit date: | 2024-05-07 | Release date: | 2024-06-19 | Method: | X-RAY DIFFRACTION (2.911 Å) | Cite: | Fragment-Based Discovery of Novel MUS81 Inhibitors Acs Med.Chem.Lett., 2024
|
|
7F6L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7f6l by Molmil](/molmil-images/mine/7f6l) | Crystal structure of human MUS81-EME2 complex | Descriptor: | Crossover junction endonuclease MUS81, Probable crossover junction endonuclease EME2 | Authors: | Hua, Z.K, Zhang, D.P, Yuan, C, Lin, Z.H. | Deposit date: | 2021-06-25 | Release date: | 2022-03-02 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | Crystal structure of the human MUS81-EME2 complex. Structure, 30, 2022
|
|
2ZIX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2zix by Molmil](/molmil-images/mine/2zix) | Crystal structure of the Mus81-Eme1 complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81 | Authors: | Chang, J.H, Kim, J.J, Choi, J.M, Lee, J.H, Cho, Y. | Deposit date: | 2008-02-25 | Release date: | 2008-04-29 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (3.5 Å) | Cite: | Crystal structure of the Mus81-Eme1 complex Genes Dev., 22, 2008
|
|
4P0S
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4p0s by Molmil](/molmil-images/mine/4p0s) | human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0R
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4p0r by Molmil](/molmil-images/mine/4p0r) | human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6.501 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
2MC3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2mc3 by Molmil](/molmil-images/mine/2mc3) | |
6VWB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6vwb by Molmil](/molmil-images/mine/6vwb) | Solution structure of the N-terminal helix-hairpin-helix domain of human MUS81 | Descriptor: | Crossover junction endonuclease MUS81 | Authors: | Payliss, B, Houliston, S, Lemak, A, Arrowsmith, C.H, Wyatt, H.D.M. | Deposit date: | 2020-02-19 | Release date: | 2021-02-24 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | Phosphorylation of the DNA repair scaffold SLX4 drives folding of the SAP domain and activation of the MUS81-EME1 endonuclease Cell Rep, 41, 2022
|
|