8CZE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8cze by Molmil](/molmil-images/mine/8cze) | Structure of a Xenopus Nucleosome with Widom 601 DNA | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Gu, Y, Ur, S.N, Milano, C.R, Tromer, E.C, Vale-Silva, L.A, Hochwagen, A, Corbett, K.D. | Deposit date: | 2022-05-24 | Release date: | 2023-06-07 | Last modified: | 2024-04-10 | Method: | ELECTRON MICROSCOPY (2.58 Å) | Cite: | Chromatin binding by HORMAD proteins regulates meiotic recombination initiation. Embo J., 43, 2024
|
|
4J8V
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4j8v by Molmil](/molmil-images/mine/4j8v) | |
3REK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3rek by Molmil](/molmil-images/mine/3rek) | |
5CP6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5cp6 by Molmil](/molmil-images/mine/5cp6) | Nucleosome Core Particle with Adducts from the Anticancer Compound, [(eta6-5,8,9,10-tetrahydroanthracene)Ru(ethylenediamine)Cl][PF6] | Descriptor: | (ethane6-5,8,9,10-tetrahydroanthracene)Ru(II)(ethylene-diamine)Cl, DNA (145-MER), Histone H2A, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2015-07-21 | Release date: | 2016-06-01 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | An Organometallic Compound which Exhibits a DNA Topology-Dependent One-Stranded Intercalation Mode. Angew.Chem.Int.Ed.Engl., 55, 2016
|
|
1KX4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx4 by Molmil](/molmil-images/mine/1kx4) | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
7SWY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7swy by Molmil](/molmil-images/mine/7swy) | 2.6 A structure of a 40-601[TA-rich+1]-40 nucleosome | Descriptor: | DNA Guide Strand, DNA Tracking Strand, Histone H2A, ... | Authors: | Nodelman, I.M, Bowman, G.D, Armache, J.-P. | Deposit date: | 2021-11-21 | Release date: | 2022-03-02 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (2.6 Å) | Cite: | Nucleosome recognition and DNA distortion by the Chd1 remodeler in a nucleotide-free state. Nat.Struct.Mol.Biol., 29, 2022
|
|
4WU9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4wu9 by Molmil](/molmil-images/mine/4wu9) | Structure of cisPtNAP-NCP145 | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | Authors: | Chua, E.Y.D, Davey, G.E, Chin, C.F, Droge, P, Ang, W.H, Davey, C.A. | Deposit date: | 2014-10-31 | Release date: | 2015-09-02 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Stereochemical control of nucleosome targeting by platinum-intercalator antitumor agents. Nucleic Acids Res., 43, 2015
|
|
5F99
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5f99 by Molmil](/molmil-images/mine/5f99) | |
5XF6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xf6 by Molmil](/molmil-images/mine/5xf6) | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having an ethylenediamine linker | Descriptor: | DNA (145-MER), ETHANE-1,2-DIAMINE, Histone H2A, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.63 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
3REI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3rei by Molmil](/molmil-images/mine/3rei) | |
2NZD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2nzd by Molmil](/molmil-images/mine/2nzd) | Nucleosome core particle containing 145 bp of DNA | Descriptor: | DNA (145-MER), Histone H2B, Histone H3, ... | Authors: | Ong, M.S, Richmond, T.J, Davey, C.A. | Deposit date: | 2006-11-23 | Release date: | 2007-04-10 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.65 Å) | Cite: | DNA stretching and extreme kinking in the nucleosome core J.Mol.Biol., 368, 2007
|
|
1M1A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1m1a by Molmil](/molmil-images/mine/1m1a) | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2002-06-18 | Release date: | 2003-02-18 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.65 Å) | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands J.MOL.BIOL., 326, 2003
|
|
8PEO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8peo by Molmil](/molmil-images/mine/8peo) | H3K36me2 nucleosome-LEDGF/p75 PWWP domain complex | Descriptor: | (2R)-2-amino-3-(2-dimethylaminoethylsulfanyl)propanoic acid, Histone H2A, Histone H2B 1.1, ... | Authors: | Koutna, E, Kouba, T, Veverka, V. | Deposit date: | 2023-06-14 | Release date: | 2023-08-16 | Last modified: | 2023-11-15 | Method: | ELECTRON MICROSCOPY (2.69 Å) | Cite: | Multivalency of nucleosome recognition by LEDGF. Nucleic Acids Res., 51, 2023
|
|
1P34
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1p34 by Molmil](/molmil-images/mine/1p34) | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1P3P
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1p3p by Molmil](/molmil-images/mine/1p3p) | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1P3G
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1p3g by Molmil](/molmil-images/mine/1p3g) | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
6N1Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6n1z by Molmil](/molmil-images/mine/6n1z) | Importin-9 bound to H2A-H2B | Descriptor: | Histone H2A, Histone H2B 1.1, Importin-9 | Authors: | Tomchick, D.R, Chook, Y.M, Padavannil, A. | Deposit date: | 2018-11-12 | Release date: | 2019-03-20 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Importin-9 wraps around the H2A-H2B core to act as nuclear importer and histone chaperone. Elife, 8, 2019
|
|
3REL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3rel by Molmil](/molmil-images/mine/3rel) | |
8CWW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8cww by Molmil](/molmil-images/mine/8cww) | Structure of S. cerevisiae Hop1 CBR bound to a nucleosome | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Gu, Y, Ur, S.N, Milano, C.R, Tromer, E.C, Vale-Silva, L.A, Hochwagen, A, Corbett, K.D. | Deposit date: | 2022-05-19 | Release date: | 2023-06-07 | Last modified: | 2024-04-10 | Method: | ELECTRON MICROSCOPY (2.74 Å) | Cite: | Chromatin binding by HORMAD proteins regulates meiotic recombination initiation. Embo J., 43, 2024
|
|
1P3O
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1p3o by Molmil](/molmil-images/mine/1p3o) | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.75 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
3LJA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3lja by Molmil](/molmil-images/mine/3lja) | |
5ONG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ong by Molmil](/molmil-images/mine/5ong) | X-Ray crystal structure of a nucleosome core particle with its DNA site-specifically crosslinked to the histone octamer | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | Authors: | Frouws, T.D, Barth, P.D, Richmond, T.J. | Deposit date: | 2017-08-03 | Release date: | 2017-11-22 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (2.797 Å) | Cite: | Site-Specific Disulfide Crosslinked Nucleosomes with Enhanced Stability. J. Mol. Biol., 430, 2018
|
|
8V4Y
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8v4y by Molmil](/molmil-images/mine/8v4y) | Cryo-EM structure of singly-bound SNF2h-nucleosome complex with SNF2h at inactive SHL2 (conformation 1) | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, BERYLLIUM TRIFLUORIDE ION, Histone H2A type 1, ... | Authors: | Chio, U.S, Palovcak, E, Armache, J.P, Narlikar, G.J, Cheng, Y. | Deposit date: | 2023-11-29 | Release date: | 2024-03-20 | Method: | ELECTRON MICROSCOPY (2.8 Å) | Cite: | Functionalized graphene-oxide grids enable high-resolution cryo-EM structures of the SNF2h-nucleosome complex without crosslinking. Nat Commun, 15, 2024
|
|
8V6V
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8v6v by Molmil](/molmil-images/mine/8v6v) | Cryo-EM structure of doubly-bound SNF2h-nucleosome complex | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Histone H2A type 1, Histone H2B, ... | Authors: | Chio, U.S, Palovcak, E, Armache, J.P, Narlikar, G.J, Cheng, Y. | Deposit date: | 2023-12-03 | Release date: | 2024-03-20 | Method: | ELECTRON MICROSCOPY (2.8 Å) | Cite: | Functionalized graphene-oxide grids enable high-resolution cryo-EM structures of the SNF2h-nucleosome complex without crosslinking. Nat Commun, 15, 2024
|
|
7ENN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7enn by Molmil](/molmil-images/mine/7enn) | The structure of ALC1 bound to the nucleosome | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, BERYLLIUM TRIFLUORIDE ION, Chromodomain-helicase-DNA-binding protein 1-like, ... | Authors: | Chen, Z.C, Chen, K.J, Wang, L. | Deposit date: | 2021-04-18 | Release date: | 2021-07-14 | Method: | ELECTRON MICROSCOPY (2.8 Å) | Cite: | Structural basis of ALC1/CHD1L autoinhibition and the mechanism of activation by the nucleosome. Nat Commun, 12, 2021
|
|