1NJQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1njq by Molmil](/molmil-images/mine/1njq) | NMR structure of the single QALGGH zinc finger domain from Arabidopsis thaliana SUPERMAN protein | Descriptor: | ZINC ION, superman protein | Authors: | Isernia, C, Bucci, E, Leone, M, Zaccaro, L, Di Lello, P, Digilio, G, Esposito, S, Saviano, M, Di Blasio, B, Pedone, C, Pedone, P.V, Fattorusso, R. | Deposit date: | 2003-01-02 | Release date: | 2003-03-04 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | NMR Structure of the Single QALGGH Zinc Finger Domain from the Arabidopsis thaliana SUPERMAN Protein. Chembiochem, 4, 2003
|
|
1PQQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1pqq by Molmil](/molmil-images/mine/1pqq) | NMR Structure of a Cyclic Polyamide-DNA Complex | Descriptor: | 45-(3-AMINOPROPYL)-5,11,22,28,34-PENTAMETHYL-3,9,15,20,26,32,38,43-OCTAOXO-2,5,8,14,19,22,25,28,31,34,37,42,45,48-TETRADECAAZA-11-AZONIAHEPTACYCLO[42.2.1.1~4,7~.1~10,13~.1~21,24~.1~27,30~.1~33,36~]DOPENTACONTA-1(46),4(52),6,10(51),12,21(50),23,27(49),29,33(48),35,44(47)-DODECAENE, 5'-D(*CP*GP*CP*TP*AP*AP*CP*AP*GP*GP*C)-3', 5'-D(*GP*CP*CP*TP*GP*TP*TP*AP*GP*CP*G)-3' | Authors: | Zhang, Q, Dwyer, T.J, Tsui, V, Case, D.A, Cho, J, Dervan, P.B, Wemmer, D.E. | Deposit date: | 2003-06-18 | Release date: | 2004-06-29 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structure of a Cyclic Polyamide-DNA Complex. J.Am.Chem.Soc., 126, 2004
|
|
1PN5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1pn5 by Molmil](/molmil-images/mine/1pn5) | NMR structure of the NALP1 Pyrin domain (PYD) | Descriptor: | NACHT-, LRR- and PYD-containing protein 2 | Authors: | Hiller, S, Kohl, A, Fiorito, F, Herrmann, T, Wider, G, Tschopp, J, Grutter, M.G, Wuthrich, K. | Deposit date: | 2003-06-12 | Release date: | 2003-10-07 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR structure of the apoptosis- and inflammation-related NALP1 pyrin domain Structure, 11, 2003
|
|
6JCE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6jce by Molmil](/molmil-images/mine/6jce) | NMR solution and X-ray crystal structures of a DNA containing both right-and left-handed parallel-stranded G-quadruplexes | Descriptor: | 29-mer DNA | Authors: | Winnerdy, F.R, Bakalar, B, Maity, A, Vandana, J.J, Mechulam, Y, Schmitt, E, Phan, A.T. | Deposit date: | 2019-01-28 | Release date: | 2019-07-10 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | NMR solution and X-ray crystal structures of a DNA molecule containing both right- and left-handed parallel-stranded G-quadruplexes. Nucleic Acids Res., 47, 2019
|
|
1KC4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kc4 by Molmil](/molmil-images/mine/1kc4) | NMR Structural Analysis of the Complex Formed Between alpha-Bungarotoxin and the Principal alpha-Neurotoxin Binding Sequence on the alpha7 Subunit of a Neuronal Nicotinic Acetylcholine Receptor | Descriptor: | alpha-bungarotoxin, neuronal acetylcholine receptor protein, alpha-7 chain | Authors: | Moise, L, Piserchio, A, Basus, V.J, Hawrot, E. | Deposit date: | 2001-11-07 | Release date: | 2002-03-13 | Last modified: | 2021-10-27 | Method: | SOLUTION NMR | Cite: | NMR structural analysis of alpha-bungarotoxin and its complex with the principal alpha-neurotoxin-binding sequence on the alpha 7 subunit of a neuronal nicotinic acetylcholine receptor. J.Biol.Chem., 277, 2002
|
|
1QS3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qs3 by Molmil](/molmil-images/mine/1qs3) | NMR SOLUTION CONFORMATION OF AN ANTITOXIC ANALOG OF ALPHA-CONOTOXIN GI | Descriptor: | DES-GLU1-[CYS3ALA]-DES-CYS13-ALPHA CONOTOXIN GI | Authors: | Mok, K.H, Han, K.-H. | Deposit date: | 1999-06-25 | Release date: | 1999-10-06 | Last modified: | 2014-03-12 | Method: | SOLUTION NMR | Cite: | NMR solution conformation of an antitoxic analogue of alpha-conotoxin GI: identification of a common nicotinic acetylcholine receptor alpha 1-subunit binding surface for small ligands and alpha-conotoxins. Biochemistry, 38, 1999
|
|
1F5Y
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1f5y by Molmil](/molmil-images/mine/1f5y) | NMR STRUCTURE OF A CONCATEMER OF THE FIRST AND SECOND LIGAND-BINDING MODULES OF THE HUMAN LDL RECEPTOR | Descriptor: | CALCIUM ION, LOW-DENSITY LIPOPROTEIN RECEPTOR | Authors: | Kurniawan, N.D, Atkins, A.R, Brereton, I.M, Kroon, P.A, Smith, R. | Deposit date: | 2000-06-18 | Release date: | 2000-08-30 | Last modified: | 2022-02-16 | Method: | SOLUTION NMR | Cite: | NMR structure of a concatemer of the first and second ligand-binding modules of the human low-density lipoprotein receptor. Protein Sci., 9, 2000
|
|
1TH5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1th5 by Molmil](/molmil-images/mine/1th5) | Solution structure of C-terminal domain of NifU-like protein from Oryza sativa | Descriptor: | NifU1 | Authors: | Kumeta, H, Ogura, K, Asayama, M, Katoh, S, Katoh, E, Inagaki, F. | Deposit date: | 2004-06-01 | Release date: | 2005-09-27 | Last modified: | 2024-05-29 | Method: | SOLUTION NMR | Cite: | The NMR structure of the domain II of a chloroplastic NifU-like protein OsNifU1A. J.Biomol.Nmr, 38, 2007
|
|
1NAU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1nau by Molmil](/molmil-images/mine/1nau) | NMR Solution Structure of the Glucagon Antagonist [desHis1, desPhe6, Glu9]Glucagon Amide in the Presence of Perdeuterated Dodecylphosphocholine Micelles | Descriptor: | Glucagon | Authors: | Ying, J, Ahn, J.-M, Jacobsen, N.E, Brown, M.F, Hruby, V.J. | Deposit date: | 2002-11-28 | Release date: | 2003-03-18 | Last modified: | 2021-10-27 | Method: | SOLUTION NMR | Cite: | NMR Solution Structure of the Glucagon Antagonist [desHis1, desPhe6, Glu9]Glucagon Amide in the Presence of Perdeuterated Dodecylphosphocholine Micelles Biochemistry, 42, 2003
|
|
1F53
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1f53 by Molmil](/molmil-images/mine/1f53) | NMR STRUCTURE OF KILLER TOXIN-LIKE PROTEIN SKLP | Descriptor: | YEAST KILLER TOXIN-LIKE PROTEIN | Authors: | Ohki, S, Kariya, E, Hiraga, K, Wakamiya, A, Isobe, T, Oda, K, Kainosho, M. | Deposit date: | 2000-06-12 | Release date: | 2000-12-27 | Last modified: | 2022-02-16 | Method: | SOLUTION NMR | Cite: | NMR structure of Streptomyces killer toxin-like protein, SKLP: further evidence for the wide distribution of single-domain betagamma-crystallin superfamily proteins. J.Mol.Biol., 305, 2001
|
|
1JBD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1jbd by Molmil](/molmil-images/mine/1jbd) | NMR Structure of the Complex Between alpha-bungarotoxin and a Mimotope of the Nicotinic Acetylcholine Receptor | Descriptor: | LONG NEUROTOXIN 1, MIMOTOPE OF THE NICOTINIC ACETYLCHOLINE RECEPTOR | Authors: | Scarselli, M, Spiga, O, Ciutti, A, Bracci, L, Lelli, B, Lozzi, L, Calamandrei, D, Bernini, A, Di Maro, D, Klein, S, Niccolai, N. | Deposit date: | 2001-06-04 | Release date: | 2001-06-27 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | NMR structure of alpha-bungarotoxin free and bound to a mimotope of the nicotinic acetylcholine receptor. Biochemistry, 41, 2002
|
|
1EVO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1evo by Molmil](/molmil-images/mine/1evo) | NMR OBSERVATION OF A NOVEL C-TETRAD | Descriptor: | DNA (5'-D(*TP*GP*GP*GP*CP*GP*GP*T)-3') | Authors: | Patel, P.K, Bhavesh, N.S, Hosur, R.V. | Deposit date: | 2000-04-20 | Release date: | 2000-05-01 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR observation of a novel C-tetrad in the structure of the SV40 repeat sequence GGGCGG. Biochem.Biophys.Res.Commun., 270, 2000
|
|
1R7Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1r7z by Molmil](/molmil-images/mine/1r7z) | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1G1Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1g1z by Molmil](/molmil-images/mine/1g1z) | NMR Solution Structures of delta-Conotoxin EVIA from Conus ermineus that Selectively Acts on Vertebrate Neuronal Na+ Channels, LEU12-PRO13 Cis isomer | Descriptor: | CONOTOXIN EVIA | Authors: | Volpon, L, Lamthanh, H, Le Gall, F, Menez, A, Lancelin, J.M. | Deposit date: | 2000-10-16 | Release date: | 2000-11-01 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | NMR Solution Structures of delta-Conotoxin EVIA from Conus ermineus That Selectively Acts on Vertebrate Neuronal Na+ Channels. J.Biol.Chem., 279, 2004
|
|
1R7W
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1r7w by Molmil](/molmil-images/mine/1r7w) | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1EGO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ego by Molmil](/molmil-images/mine/1ego) | NMR STRUCTURE OF OXIDIZED ESCHERICHIA COLI GLUTAREDOXIN: COMPARISON WITH REDUCED E. COLI GLUTAREDOXIN AND FUNCTIONALLY RELATED PROTEINS | Descriptor: | GLUTAREDOXIN | Authors: | Xia, T.-H, Bushweller, J.H, Sodano, P, Billeter, M, Bjornberg, O, Holmgren, A, Wuthrich, K. | Deposit date: | 1991-10-08 | Release date: | 1993-10-31 | Last modified: | 2022-02-16 | Method: | SOLUTION NMR | Cite: | NMR structure of oxidized Escherichia coli glutaredoxin: comparison with reduced E. coli glutaredoxin and functionally related proteins. Protein Sci., 1, 1992
|
|
1G1P
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1g1p by Molmil](/molmil-images/mine/1g1p) | NMR Solution Structures of delta-Conotoxin EVIA from Conus ermineus that Selectively Acts on Vertebrate Neuronal Na+ Channels | Descriptor: | CONOTOXIN EVIA | Authors: | Volpon, L, Lamthanh, H, Barbier, J, Gilles, N, Molgo, J, Menez, A, Lancelin, J.M. | Deposit date: | 2000-10-13 | Release date: | 2000-11-01 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | NMR Solution Structures of delta-Conotoxin EVIA from Conus ermineus That Selectively Acts on Vertebrate Neuronal Na+ Channels. J.Biol.Chem., 279, 2004
|
|
1FV8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1fv8 by Molmil](/molmil-images/mine/1fv8) | NMR STUDY OF AN HETEROCHIRAL HAIRPIN | Descriptor: | 5'-D(*TP*AP*TP*CP*AP*(0DT)P*CP*GP*AP*TP*A)-3' | Authors: | El Amri, C, Mauffret, O, Santamaria, F, Rayner, B, Fermandjian, S. | Deposit date: | 2000-09-19 | Release date: | 2000-10-11 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | NMR study of a heterochiral DNA hairpin:impact of L-enantiomery in the loop. J.Biomol.Struct.Dyn., 19, 2001
|
|
1IK8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ik8 by Molmil](/molmil-images/mine/1ik8) | NMR structure of Alpha-Bungarotoxin | Descriptor: | LONG NEUROTOXIN 1 | Authors: | Niccolai, N, Ciutti, A, Spiga, O. | Deposit date: | 2001-05-03 | Release date: | 2001-05-16 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | NMR structure of alpha-bungarotoxin free and bound to a mimotope of the nicotinic acetylcholine receptor. Biochemistry, 41, 2002
|
|
1RY3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ry3 by Molmil](/molmil-images/mine/1ry3) | NMR Solution Structure of the Precursor for Carnobacteriocin B2, an Antimicrobial Peptide from Carnobacterium piscicola | Descriptor: | Bacteriocin carnobacteriocin B2 | Authors: | Sprules, T, Kawulka, K.E, Gibbs, A.C, Wishart, D.S, Vederas, J.C. | Deposit date: | 2003-12-19 | Release date: | 2004-05-04 | Last modified: | 2022-03-02 | Method: | SOLUTION NMR | Cite: | NMR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide from Carnobacterium piscicola. Eur.J.Biochem., 271, 2004
|
|
1FAF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1faf by Molmil](/molmil-images/mine/1faf) | NMR STRUCTURE OF THE N-TERMINAL J DOMAIN OF MURINE POLYOMAVIRUS T ANTIGENS. | Descriptor: | LARGE T ANTIGEN | Authors: | Berjanskii, M.V, Riley, M.I, Xie, A, Semenchenko, V, Folk, W.R, Van Doren, S.R. | Deposit date: | 2000-07-13 | Release date: | 2000-11-22 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR structure of the N-terminal J domain of murine polyomavirus T antigens. Implications for DnaJ-like domains and for mutations of T antigens. J.Biol.Chem., 275, 2000
|
|
1EMQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1emq by Molmil](/molmil-images/mine/1emq) | |
1KL8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kl8 by Molmil](/molmil-images/mine/1kl8) | NMR STRUCTURAL ANALYSIS OF THE COMPLEX FORMED BETWEEN ALPHA-BUNGAROTOXIN AND THE PRINCIPAL ALPHA-NEUROTOXIN BINDING SEQUENCE ON THE ALPHA7 SUBUNIT OF A NEURONAL NICOTINIC ACETYLCHOLINE RECEPTOR | Descriptor: | ALPHA-BUNGAROTOXIN, NEURONAL ACETYLCHOLINE RECEPTOR PROTEIN, ALPHA-7 CHAIN | Authors: | Moise, L, Piserchio, A, Basus, V.J, Hawrot, E. | Deposit date: | 2001-12-11 | Release date: | 2002-03-13 | Last modified: | 2021-10-27 | Method: | SOLUTION NMR | Cite: | NMR structural analysis of alpha-bungarotoxin and its complex with the principal alpha-neurotoxin-binding sequence on the alpha 7 subunit of a neuronal nicotinic acetylcholine receptor. J.Biol.Chem., 277, 2002
|
|
1IKC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ikc by Molmil](/molmil-images/mine/1ikc) | NMR Structure of alpha-Bungarotoxin | Descriptor: | long neurotoxin 1 | Authors: | Niccolai, N, Spiga, O, Ciutti, A. | Deposit date: | 2001-05-03 | Release date: | 2001-05-16 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | NMR structure of alpha-bungarotoxin free and bound to a mimotope of the nicotinic acetylcholine receptor. Biochemistry, 41, 2002
|
|
1EQ3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1eq3 by Molmil](/molmil-images/mine/1eq3) | NMR STRUCTURE OF HUMAN PARVULIN HPAR14 | Descriptor: | PEPTIDYL-PROLYL CIS/TRANS ISOMERASE (PPIASE) | Authors: | Sekerina, E, Rahfeld, U.J, Muller, J, Fischer, G, Bayer, P. | Deposit date: | 2000-04-02 | Release date: | 2001-04-04 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR solution structure of hPar14 reveals similarity to the peptidyl prolyl cis/trans isomerase domain of the mitotic regulator hPin1 but indicates a different functionality of the protein. J.Mol.Biol., 301, 2000
|
|