PDB: 72678 resultsInfo pagesStatus searchChemie searchBIRD

---

2FY1	A dual mode of RNA recognition by the RBMY protein Descriptor: RNA-binding motif protein, Y chromosome, family 1 member A1, ... Authors: Skrisovska, L, Bourgois, C, Stefl, R, Kister, L, Wenter, P, Elliot, D, Stevenin, J, Allain, F.H.T. Deposit date: 2006-02-07 Release date: 2007-02-06 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: The testis-specific human protein RBMY recognizes RNA through a novel mode of interaction. EMBO Rep., 8, 2007
5UEE	RNA primer-template complex with guanosine dinucleotide ligand G(5')ppp(5')G Descriptor: DIGUANOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*GP*AP*CP*UP*UP*AP*AP*GP*UP*CP*G)-3') Authors: Zhang, W, Tam, C.P, Szostak, J.W. Deposit date: 2017-01-01 Release date: 2017-07-05 Last modified: 2023-10-04 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Insight into the mechanism of nonenzymatic RNA primer extension from the structure of an RNA-GpppG complex. Proc. Natl. Acad. Sci. U.S.A., 114, 2017
1N66	Structure of the pyrimidine-rich internal loop in the Y-domain of poliovirus 3'UTR Descriptor: internal loop in the Y-domain of poliovirus 3'UTR Authors: Lescrinier, E.M, Tessari, M, van Kuppeveld, F.J, Melchers, W.J, Hilbers, C.W, Heus, H.A. Deposit date: 2002-11-08 Release date: 2003-08-19 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Structure of the Pyrimidine-rich Internal Loop in the Poliovirus 3'-UTR: The Importance of Maintaining Pseudo-2-fold Symmetry in RNA Helices Containing Two Adjacent Non-canonical Base-pairs. J.Mol.Biol., 331, 2003
1S76	T7 RNA polymerase alpha beta methylene ATP elongation complex Descriptor: DIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER, DNA (5'-D(P*GP*CP*CP*GP*TP*GP*CP*GP*CP*AP*TP*TP*CP*GP*CP*CP*GP*TP*GP*TP*T)-3'), DNA (5'-D(P*TP*TP*TP*AP*CP*GP*TP*TP*GP*CP*GP*CP*AP*CP*GP*GP*C)-3'), ... Authors: Yin, Y.W, Steitz, T.A. Deposit date: 2004-01-29 Release date: 2004-03-23 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (2.88 Å) Cite: The structural mechanism of translocation and helicase activity in T7 RNA polymerase. Cell(Cambridge,Mass.), 116, 2004
1SCL	THE SARCIN-RICIN LOOP, A MODULAR RNA Descriptor: RNA SARCIN-RICIN LOOP Authors: Szewczak, A.A, Moore, P.B. Deposit date: 1994-11-11 Release date: 1995-01-26 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: The conformation of the sarcin/ricin loop from 28S ribosomal RNA. Proc.Natl.Acad.Sci.USA, 90, 1993
1TLR	SOLUTION STRUCTURE OF TETRALOOP RECEPTOR RNA, NMR, 20 STRUCTURES Descriptor: RNA TETRALOOP RECEPTOR (5'-R(GGCCUAAGACUUCGGUUAUGGCC)-3') Authors: Butcher, S.E, Dieckmann, T, Feigon, J. Deposit date: 1997-09-11 Release date: 1997-11-12 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Solution structure of a GAAA tetraloop receptor RNA. EMBO J., 16, 1997
2V6W	tRNASer acceptor stem: Conformation and hydration of a microhelix in a crystal structure at 1.8 Angstrom resolution Descriptor: 5'-R(*GP*GP*AP*GP*AP*GP*AP)-3', 5'-R(*UP*CP*UP*CP*UP*CP*CP)-3' Authors: Foerster, C, Brauer, A.B.E, Brode, S, Fuerste, J.P, Betzel, C, Erdmann, V.A. Deposit date: 2007-07-23 Release date: 2007-11-06 Last modified: 2024-05-08 Method: X-RAY DIFFRACTION (1.8 Å) Cite: Trnaser Acceptor Stem: Conformation and Hydration of a Microhelix in a Crystal Structure at 1.8 A Resolution. Acta Crystallogr.,Sect.D, 63, 2007
8SX6	RNA duplex bound with GMP and AMP monomers Descriptor: ADENOSINE MONOPHOSPHATE, GUANOSINE-5'-MONOPHOSPHATE, MAGNESIUM ION, ... Authors: Zhang, W, Dantsu, Y. Deposit date: 2023-05-19 Release date: 2023-05-31 Last modified: 2023-12-13 Method: X-RAY DIFFRACTION (1.45 Å) Cite: Insight into the structures of unusual base pairs in RNA complexes containing a primer/template/adenosine ligand. Rsc Chem Biol, 4, 2023
8SWG	RNA duplex bound with GpppA dinucleotide ligand Descriptor: GUANOSINE-P3-ADENOSINE-5',5'-TRIPHOSPHATE, RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG)P*AP*CP*UP*UP*AP*AP*GP*UP*CP*G*(GA3))-3') Authors: Zhang, W, Dantsu, Y. Deposit date: 2023-05-18 Release date: 2023-05-31 Last modified: 2023-12-13 Method: X-RAY DIFFRACTION (1.5 Å) Cite: Insight into the structures of unusual base pairs in RNA complexes containing a primer/template/adenosine ligand. Rsc Chem Biol, 4, 2023
8SXL	RNA UU template binding to AMP monomer Descriptor: ADENOSINE MONOPHOSPHATE, RNA (5'-R(*(TLN)P*(TLN)P*(LCA)P*(LCG)P*AP*CP*UP*UP*AP*AP*GP*UP*CP*U)-3') Authors: Zhang, W, Dantsu, Y. Deposit date: 2023-05-22 Release date: 2023-05-31 Last modified: 2023-12-13 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Insight into the structures of unusual base pairs in RNA complexes containing a primer/template/adenosine ligand. Rsc Chem Biol, 4, 2023
2JWV	Structure of a high affinity anti-NFkB RNA aptamer Descriptor: RNA (29-MER) Authors: Reiter, N.J, Maher III, L, Butcher, S.E. Deposit date: 2007-10-25 Release date: 2008-01-08 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: DNA mimicry by a high-affinity anti-NF-kappaB RNA aptamer Nucleic Acids Res., 36, 2008
1NBR	Iron Responsive Element RNA Hairpin, NMR, 15 Structures Descriptor: RNA HAIRPIN Authors: McCallum, S.A, Pardi, A. Deposit date: 2002-12-03 Release date: 2003-03-04 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Refined Solution Structure of the Iron-responsive Element RNA Using Residual Dipolar Couplings J.Mol.Biol., 326, 2003
2LUB	High resolution NMR solution structure of helix H1 of the human HAR1 RNA Descriptor: RNA (37-MER) Authors: Cevec, M, Ziegeler, M, Richter, C, Schwalbe, H. Deposit date: 2012-06-11 Release date: 2012-07-25 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: NMR Studies of HAR1 RNA Secondary Structures Reveal Conformational Dynamics in the Human RNA. Chembiochem, 13, 2012
4AU6	Location of the dsRNA-dependent polymerase, VP1, in rotavirus particles Descriptor: RNA-DEPENDENT RNA POLYMERASE Authors: Estrozi, L.F, Settembre, E.C, Goret, G, McClain, B, Zhang, X, Chen, J.Z, Grigorieff, N, Harrison, S.C. Deposit date: 2012-05-14 Release date: 2012-06-13 Last modified: 2024-05-08 Method: ELECTRON MICROSCOPY (6 Å) Cite: Location of the Dsrna-Dependent Polymerase, Vp1, in Rotavirus Particles. J.Mol.Biol., 425, 2013
1KOD	RNA APTAMER COMPLEXED WITH CITRULLINE, NMR Descriptor: CITRULLINE, RNA (5'-R(P*AP*CP*GP*GP*UP*UP*AP*GP*GP*UP*CP*GP*CP*U)-3'), RNA (5'-R(P*AP*GP*AP*AP*GP*GP*AP*GP*UP*GP*U)-3') Authors: Yang, Y.S, Kochoyan, M, Burgstaller, P, Westhof, E, Famulok, M. Deposit date: 1996-03-28 Release date: 1996-11-08 Last modified: 2023-11-15 Method: SOLUTION NMR Cite: Structural basis of ligand discrimination by two related RNA aptamers resolved by NMR spectroscopy. Science, 272, 1996
1KOC	RNA APTAMER COMPLEXED WITH ARGININE, NMR Descriptor: ARGININE, RNA (5'-R(P*AP*CP*AP*GP*GP*UP*AP*GP*GP*UP*CP*GP*CP*U)-3'), RNA (5'-R(P*AP*GP*AP*AP*GP*GP*AP*GP*CP*GP*U)-3') Authors: Yang, Y.S, Kochoyan, M, Burgstaller, P, Westhof, E, Famulok, M. Deposit date: 1996-03-28 Release date: 1996-08-17 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Structural basis of ligand discrimination by two related RNA aptamers resolved by NMR spectroscopy. Science, 272, 1996
2MQT	Solution NMR structure of the U5-primer binding site (U5-PBS) domain of murine leukemia virus RNA genome Descriptor: RNA (68-MER) Authors: D'Souza, V, Yildiz, Z. Deposit date: 2014-06-26 Release date: 2014-09-10 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: A structure-based mechanism for tRNA and retroviral RNA remodelling during primer annealing. Nature, 515, 2014
1F5U	SOLUTION STRUCTURE OF THE KISSING DIMER OF H3 GACG STEM-LOOP IN THE 5'-END DIMERIZATION SIGNAL OF MOLONEY MURINE LEUKEMIA VIRUS GENOMIC RNA Descriptor: RNA (5'-R(*GP*GP*UP*GP*GP*GP*AP*GP*AP*CP*GP*UP*CP*CP*CP*AP*CP*C)-3') Authors: Kim, C.-H, Tinoco Jr, I. Deposit date: 2000-06-16 Release date: 2000-08-21 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: A retroviral RNA kissing complex containing only two G.C base pairs. Proc.Natl.Acad.Sci.USA, 97, 2000
2LHP	High resolution NMR solution structure of helix H1 of the chimpanzee HAR1 RNA Descriptor: RNA (37-MER) Authors: Cevec, M, Ziegeler, M, Richter, C, Schwalbe, H. Deposit date: 2011-08-12 Release date: 2012-07-25 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: NMR Studies of HAR1 RNA Secondary Structures Reveal Conformational Dynamics in the Human RNA. Chembiochem, 13, 2012
1NS1	RNA-BINDING DOMAIN OF NON-STRUCTURAL PROTEIN 1 FROM INFLUENZA VIRUS, NMR, 16 STRUCTURES Descriptor: NONSTRUCTURAL PROTEIN 1 Authors: Montelione, G.T, Chien, C.-Y, Tejero, R. Deposit date: 1997-10-02 Release date: 1998-01-14 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: A novel RNA-binding motif in influenza A virus non-structural protein 1. Nat.Struct.Biol., 4, 1997
2N2P	Solution structure of a double base-pair inversion mutant of murine tumour necrosis factor alpha CDE-23 RNA Descriptor: RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') Authors: Codutti, L, Leppek, K, Zalesak, J, Windeisen, V, Masiewicz, P, Stoecklin, G, Carlomagno, T. Deposit date: 2015-05-11 Release date: 2015-08-05 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: A Distinct, Sequence-Induced Conformation Is Required for Recognition of the Constitutive Decay Element RNA by Roquin. Structure, 23, 2015
2N2O	Structure of murine tumour necrosis factor alpha CDE RNA Descriptor: RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') Authors: Codutti, L, Leppek, K, Zalesak, J, Windeisen, V, Masiewicz, P, Stoecklin, G, Carlomagno, T. Deposit date: 2015-05-11 Release date: 2015-08-05 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: A Distinct, Sequence-Induced Conformation Is Required for Recognition of the Constitutive Decay Element RNA by Roquin. Structure, 23, 2015
1ELH	NMR ANALYSIS OF HELIX I FROM THE 5S RNA OF ESCHERICHIA COLI Descriptor: RNA (5'-R(*AP*AP*CP*UP*GP*CP*CP*AP*GP*GP*CP*AP*U)-3'), RNA (5'-R(*UP*UP*GP*CP*CP*UP*GP*GP*CP*GP*GP*C)-3') Authors: White, S, Moore, P. Deposit date: 1993-06-23 Release date: 1994-01-31 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: NMR analysis of helix I from the 5S RNA of Escherichia coli. Biochemistry, 31, 1992
1PJG	RNA/DNA Hybrid Decamer of CAAAGAAAAG/CTTTTCTTTG Descriptor: 5'-D(*CP*TP*TP*TP*TP*CP*TP*TP*TP*G)-3', 5'-R(*CP*AP*AP*AP*GP*AP*AP*AP*AP*G)-3', CALCIUM ION Authors: Kopka, M.L, Lavelle, L, Han, G.W, Ng, H.-L, Dickerson, R.E. Deposit date: 2003-06-02 Release date: 2003-12-09 Last modified: 2024-04-03 Method: X-RAY DIFFRACTION (1.15 Å) Cite: An unusual sugar conformation in the structure of an RNA/DNA decamer of the polypurine tract may affect recognition by RNase H. J.Mol.Biol., 334, 2003
2E7Y	High resolution structure of T. maritima tRNase Z Descriptor: S-1,2-PROPANEDIOL, SULFATE ION, ZINC ION, ... Authors: Ishii, R, Yokoyama, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) Deposit date: 2007-01-15 Release date: 2007-09-11 Last modified: 2023-10-25 Method: X-RAY DIFFRACTION (1.97 Å) Cite: The structure of the flexible arm of Thermotoga maritima tRNase Z differs from those of homologous enzymes Acta Crystallogr.,Sect.F, 63, 2007

<148149150151152153154155156157158159160161162163>