1QWA
 
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
8BZU
 | |
5M1W
 | | Structure of a stable G-hairpin | | Descriptor: | DNA (5'-D(*GP*TP*GP*TP*GP*GP*GP*TP*GP*TP*G)-3') | | Authors: | Gajarsky, M, Zivkovic, M.L, Stadlbauer, P, Pagano, B, Fiala, R, Amato, J, Tomaska, L, Sponer, J, Plavec, J, Trantirek, L. | | Deposit date: | 2016-10-11 | | Release date: | 2017-03-01 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Structure of a Stable G-Hairpin.
J. Am. Chem. Soc., 139, 2017
|
|
6R8E
 | | SC14 G-hairpin | | Descriptor: | DNA (5'-D(*GP*TP*GP*TP*GP*TP*GP*GP*GP*TP*GP*TP*GP*T)-3') | | Authors: | Lenarcic Zivkovic, M, Trantirek, L, Plavec, J. | | Deposit date: | 2019-04-01 | | Release date: | 2021-02-03 | | Last modified: | 2024-06-19 | | Method: | SOLUTION NMR | | Cite: | Insight into formation propensity of pseudocircular DNA G-hairpins.
Nucleic Acids Res., 49, 2021
|
|
1RKJ
 | | Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target | | Descriptor: | 5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*GP*AP*GP*UP*GP*CP*AP*UP*CP*C)-3', Nucleolin | | Authors: | Johansson, C, Finger, L.D, Trantirek, L, Mueller, T.D, Kim, S, Laird-Offringa, I.A, Feigon, J. | | Deposit date: | 2003-11-21 | | Release date: | 2004-04-27 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target.
J.Mol.Biol., 337, 2004
|
|
2M21
 | | Solution structure of the Tetrahymena telomerase RNA stem IV terminal loop | | Descriptor: | 5'-R(*GP*GP*CP*GP*AP*UP*AP*CP*AP*CP*UP*AP*UP*UP*UP*AP*UP*CP*GP*CP*C)-3' | | Authors: | Cash, D.D, Richards, R.J, Wu, H, Trantirek, L, O'Connor, C.M, Feigon, J, Collins, K. | | Deposit date: | 2012-12-11 | | Release date: | 2013-03-20 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Structural study of elements of Tetrahymena telomerase RNA stem-loop IV domain important for function.
Rna, 12, 2006
|
|
1NA2
 | |
1QWB
 | |
2GIA
 | | Crystal structures of trypanosoma bruciei MRP1/MRP2 | | Descriptor: | ACETIC ACID, mitochondrial RNA-binding protein 1, mitochondrial RNA-binding protein 2 | | Authors: | Schumacher, M.A, Karamooz, E, Zikova, A, Trantirek, L, Lukes, J. | | Deposit date: | 2006-03-28 | | Release date: | 2006-09-05 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.89 Å) | | Cite: | Crystal Structures of T. brucei MRP1/MRP2 Guide-RNA Binding Complex Reveal RNA Matchmaking Mechanism.
Cell(Cambridge,Mass.), 126, 2006
|
|
2GJE
 | | Structure of a guideRNA-binding protein complex bound to a gRNA | | Descriptor: | RNA tetramer, guide RNA 40-mer, mitochondrial RNA-binding protein 1, ... | | Authors: | Schumacher, M.A, Karamooz, E, Zikova, A, Trantirek, L, Lukes, J. | | Deposit date: | 2006-03-30 | | Release date: | 2006-09-05 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (3.37 Å) | | Cite: | Crystal Structures of T. brucei MRP1/MRP2 Guide-RNA Binding Complex Reveal RNA Matchmaking Mechanism.
Cell(Cambridge,Mass.), 126, 2006
|
|
2GID
 | | Crystal structures of trypanosoma bruciei MRP1/MRP2 | | Descriptor: | mitochondrial RNA-binding protein 1, mitochondrial RNA-binding protein 2 | | Authors: | Schumacher, M.A, Karamooz, E, Zikova, A, Trantirek, L, Lukes, J. | | Deposit date: | 2006-03-28 | | Release date: | 2006-09-05 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (3.35 Å) | | Cite: | Crystal Structures of T. brucei MRP1/MRP2 Guide-RNA Binding Complex Reveal RNA Matchmaking Mechanism.
Cell(Cambridge,Mass.), 126, 2006
|
|
