1N8R
 
 | | Structure of large ribosomal subunit in complex with virginiamycin M | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10e, 50S ribosomal protein L13P, ... | | Authors: | Hansen, J.L, Moore, P.B, Steitz, T.A. | | Deposit date: | 2002-11-21 | | Release date: | 2003-07-22 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
|
|
3GNB
 | | Crystal structure of the RAG1 nonamer-binding domain with DNA | | Descriptor: | 5'-D(*AP*AP*TP*TP*TP*TP*CP*AP*GP*AP*AP*AP*CP*C)-3', 5'-D(*AP*GP*GP*TP*TP*TP*CP*TP*GP*AP*AP*AP*AP*C)-3', V(D)J recombination-activating protein 1 | | Authors: | Yin, F.F, Bailey, S, Innis, C.A, Steitz, T.A, Schatz, D.G. | | Deposit date: | 2009-03-16 | | Release date: | 2009-04-28 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structure of the RAG1 nonamer binding domain with DNA reveals a dimer that mediates DNA synapsis.
Nat.Struct.Mol.Biol., 16, 2009
|
|
1NJI
 | | Structure of chloramphenicol bound to the 50S ribosomal subunit | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10e, 50S ribosomal protein L13P, ... | | Authors: | Hansen, J.L, Moore, P.B, Steitz, T.A. | | Deposit date: | 2002-12-31 | | Release date: | 2003-07-22 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
|
|
1KLN
 | | DNA POLYMERASE I KLENOW FRAGMENT (E.C.2.7.7.7) MUTANT/DNA COMPLEX | | Descriptor: | DNA (5'-D(*GP*CP*CP*GP*CP*GP*AP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*TP*CP*GP*CP*GP*GP*CP*GP*GP*C)-3'), PROTEIN (DNA POLYMERASE I KLENOW FRAGMENT (E.C.2.7.7.7)), ... | | Authors: | Beese, L.S, Derbyshire, V, Steitz, T.A. | | Deposit date: | 1994-05-24 | | Release date: | 1994-11-30 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structure of DNA polymerase I Klenow fragment bound to duplex DNA.
Science, 260, 1993
|
|
3GNA
 | | Crystal structure of the RAG1 nonamer-binding domain with DNA | | Descriptor: | 5'-D(*AP*CP*TP*TP*AP*AP*CP*AP*AP*AP*AP*AP*CP*C)-3', 5'-D(*TP*GP*GP*TP*TP*TP*TP*TP*GP*TP*TP*AP*AP*G)-3', V(D)J recombination-activating protein 1 | | Authors: | Yin, F.F, Bailey, S, Innis, C.A, Steitz, T.A, Schatz, D.G. | | Deposit date: | 2009-03-16 | | Release date: | 2009-04-28 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structure of the RAG1 nonamer binding domain with DNA reveals a dimer that mediates DNA synapsis.
Nat.Struct.Mol.Biol., 16, 2009
|
|
1TAU
 | | TAQ POLYMERASE (E.C.2.7.7.7)/DNA/B-OCTYLGLUCOSIDE COMPLEX | | Descriptor: | 2-O-octyl-beta-D-glucopyranose, DNA (5'-D(*CP*GP*GP*AP*TP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*GP*AP*TP*CP*CP*G)-3'), ... | | Authors: | Eom, S.H, Wang, J, Steitz, T.A. | | Deposit date: | 1996-06-17 | | Release date: | 1997-04-18 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structure of Taq ploymerase with DNA at the polymerase active site.
Nature, 382, 1996
|
|
1VQ7
 | |
1FFY
 | | INSIGHTS INTO EDITING FROM AN ILE-TRNA SYNTHETASE STRUCTURE WITH TRNA(ILE) AND MUPIROCIN | | Descriptor: | ISOLEUCYL-TRNA, ISOLEUCYL-TRNA SYNTHETASE, MAGNESIUM ION, ... | | Authors: | Silvian, L.F, Wang, J, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-07 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Insights into editing from an ile-tRNA synthetase structure with tRNAile and mupirocin.
Science, 285, 1999
|
|
1KC8
 | | Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal Subunit | | Descriptor: | 23S RRNA, 5S RRNA, BLASTICIDIN S, ... | | Authors: | Hansen, J.L, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | | Deposit date: | 2001-11-07 | | Release date: | 2003-07-22 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3.01 Å) | | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
|
|
1TV6
 | | HIV-1 Reverse Transcriptase Complexed with CP-94,707 | | Descriptor: | 3-[4-(2-METHYL-IMIDAZO[4,5-C]PYRIDIN-1-YL)BENZYL]-3H-BENZOTHIAZOL-2-ONE, reverse transcriptase p51 subunit, reverse transcriptase p66 subunit | | Authors: | Pata, J.D, Stirtan, W.G, Goldstein, S.W, Steitz, T.A. | | Deposit date: | 2004-06-28 | | Release date: | 2004-07-20 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structure of HIV-1 reverse transcriptase bound to an inhibitor active against mutant RTs resistant to other non-nucleoside inhibitors
Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
1K73
 | | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | | Descriptor: | 23S RRNA, 5S RRNA, ANISOMYCIN, ... | | Authors: | Hansen, J, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | | Deposit date: | 2001-10-18 | | Release date: | 2003-07-22 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3.01 Å) | | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
|
|
2GM5
 | | An activated, truncated gamma-delta resolvase tetramer | | Descriptor: | Transposon gamma-delta resolvase | | Authors: | Kamtekar, S, Ho, R.S, Li, W, Steitz, T.A. | | Deposit date: | 2006-04-05 | | Release date: | 2006-06-27 | | Last modified: | 2021-10-20 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Implications of structures of synaptic tetramers of gamma delta resolvase for the mechanism of recombination.
Proc.Natl.Acad.Sci.Usa, 103, 2006
|
|
1VQN
 | |
1VQ6
 | |
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1S77
 | | T7 RNAP product pyrophosphate elongation complex | | Descriptor: | DNA (5'-D(*GP*CP*CP*GP*TP*GP*CP*GP*CP*AP*TP*TP*CP*GP*CP*CP*GP*TP*GP*TP*T)-3'), DNA (5'-D(*TP*TP*TP*AP*CP*GP*TP*TP*GP*CP*GP*CP*AP*CP*GP*GP*C)-3'), DNA-directed RNA polymerase, ... | | Authors: | Yin, Y.W, Steitz, T.A. | | Deposit date: | 2004-01-29 | | Release date: | 2004-03-23 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.69 Å) | | Cite: | The structural mechanism of translocation and helicase activity in T7 RNA polymerase.
Cell(Cambridge,Mass.), 116, 2004
|
|
1JJ2
 | | Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Klein, D.J, Schmeing, T.M, Moore, P.B, Steitz, T.A. | | Deposit date: | 2001-07-03 | | Release date: | 2001-08-01 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The kink-turn: a new RNA secondary structure motif.
EMBO J., 20, 2001
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
3OVA
 | | How the CCA-adding Enzyme Selects Adenine over Cytosine in Position 76 of tRNA | | Descriptor: | 1,2-ETHANEDIOL, CCA-adding enzyme, DIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER, ... | | Authors: | Pan, B.C, Xiong, Y, Steitz, T.A. | | Deposit date: | 2010-09-16 | | Release date: | 2010-12-01 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.98 Å) | | Cite: | How the CCA-Adding Enzyme Selects Adenine over Cytosine at Position 76 of tRNA.
Science, 330, 2010
|
|
3OV7
 | | How the CCA-Adding Enzyme Selects Adenine over Cytosine in Position 76 of tRNA | | Descriptor: | 1,2-ETHANEDIOL, ADENOSINE-5'-TRIPHOSPHATE, CCA-Adding Enzyme, ... | | Authors: | Pan, B.C, Xiong, Y, Steitz, T.A. | | Deposit date: | 2010-09-15 | | Release date: | 2010-12-01 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | How the CCA-Adding Enzyme Selects Adenine over Cytosine at Position 76 of tRNA.
Science, 330, 2010
|
|
3OUY
 | | How the CCA-adding Enzyme Selects Adenine Over Cytosine at Position 76 of tRNA | | Descriptor: | 1,2-ETHANEDIOL, CCA-Adding Enzyme, PYROPHOSPHATE 2-, ... | | Authors: | Pan, B.C, Xiong, Y, Steitz, T.A. | | Deposit date: | 2010-09-15 | | Release date: | 2010-12-01 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.69 Å) | | Cite: | How the CCA-Adding Enzyme Selects Adenine over Cytosine at Position 76 of tRNA.
Science, 330, 2010
|
|
1G6N
 | | 2.1 ANGSTROM STRUCTURE OF CAP-CAMP | | Descriptor: | ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE, CATABOLITE GENE ACTIVATOR PROTEIN | | Authors: | Passner, J.M, Schultz, S.C, Steitz, T.A. | | Deposit date: | 2000-11-07 | | Release date: | 2000-12-15 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Modeling the cAMP-induced allosteric transition using the crystal structure of CAP-cAMP at 2.1 A resolution.
J.Mol.Biol., 304, 2000
|
|
2PZS
 | | Phi29 DNA polymerase complexed with primer-template DNA (post-translocation binary complex) | | Descriptor: | 5'-d(CTAACACGTAAGCAGTC)-3', 5'-d(GACTGCTTAC)-3', DNA polymerase | | Authors: | Berman, A.J, Kamtekar, S, Goodman, J.L, Lazaro, J.M, de Vega, M, Blanco, L, Salas, M, Steitz, T.A. | | Deposit date: | 2007-05-18 | | Release date: | 2007-07-17 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structures of phi29 DNA polymerase complexed with substrate: the mechanism of translocation in B-family polymerases
Embo J., 26, 2007
|
|
2PY5
 | | Phi29 DNA polymerase complexed with single-stranded DNA | | Descriptor: | 1,2-ETHANEDIOL, 5'-d(GGACTTT)-3', DNA polymerase | | Authors: | Berman, A.J, Kamtekar, S, Goodman, J.L, Lazaro, J.M, de Vega, M, Blanco, L, Salas, M, Steitz, T.A. | | Deposit date: | 2007-05-15 | | Release date: | 2007-07-17 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Structures of phi29 DNA polymerase complexed with substrate: the mechanism of translocation in B-family polymerases
Embo J., 26, 2007
|
|
3FWE
 | | Crystal Structure of the Apo D138L CAP mutant | | Descriptor: | Catabolite gene activator, PROLINE | | Authors: | Sharma, H, Wang, J, Kong, J, Yu, S, Steitz, T. | | Deposit date: | 2009-01-17 | | Release date: | 2009-09-08 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structure of apo-CAP reveals that large conformational changes are necessary for DNA binding
Proc.Natl.Acad.Sci.USA, 106, 2009
|
|
