1IG9
 
 | | Structure of the Replicating Complex of a Pol Alpha Family DNA Polymerase | | Descriptor: | 5'-D(*AP*CP*AP*GP*GP*TP*AP*AP*GP*CP*AP*GP*TP*CP*CP*GP*CP*G)-3', 5'-D(*GP*CP*GP*GP*AP*CP*TP*GP*CP*TP*TP*AP*CP*(DOC))-3', CALCIUM ION, ... | | Authors: | Franklin, M.C, Wang, J, Steitz, T.A. | | Deposit date: | 2001-04-17 | | Release date: | 2001-06-11 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structure of the Replicating Complex of a Pol Alpha Family DNA Polymerase
Cell(Cambridge,Mass.), 105, 2001
|
|
1XHX
 | | Phi29 DNA Polymerase, orthorhombic crystal form | | Descriptor: | DNA polymerase, MAGNESIUM ION, SULFATE ION | | Authors: | Kamtekar, S, Berman, A.J, Wang, J, Lazaro, J.M, de Vega, M, Blanco, L, Salas, M, Steitz, T.A. | | Deposit date: | 2004-09-21 | | Release date: | 2004-12-07 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Insights into Strand Displacement and Processivity from the Crystal Structure of the Protein-Primed DNA Polymerase of Bacteriophage phi29
Mol.Cell, 16, 2004
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1YI2
 | | Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-11 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YHQ
 | | Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-10 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YJW
 | | Crystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S RIBOSOMAL RNA, 50S ribosomal protein L10, 50S ribosomal protein L10e, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-15 | | Release date: | 2005-04-26 | | Last modified: | 2024-07-10 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structures of Mlsbk Antibiotics Bound to Mutated Large Ribosomal Subunits Provide a Structural Explanation for Resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YJ9
 | | Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22 | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-13 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YJN
 | | Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-14 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1YIJ
 | | Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-12 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
3G6E
 | | Co-crystal structure of Homoharringtonine bound to the large ribosomal subunit | | Descriptor: | (3beta)-O~3~-[(2R)-2,6-dihydroxy-2-(2-methoxy-2-oxoethyl)-6-methylheptanoyl]cephalotaxine, 23S ribosomal RNA, 50S ribosomal protein L10E, ... | | Authors: | Gurel, G, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2009-02-06 | | Release date: | 2009-04-28 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome.
J.Mol.Biol., 389, 2009
|
|
1K8A
 | | Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T. | | Deposit date: | 2001-10-23 | | Release date: | 2002-07-19 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit.
Mol.Cell, 10, 2002
|
|
3G71
 | | Co-crystal structure of Bruceantin bound to the large ribosomal subunit | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10E, 50S ribosomal protein L10e, ... | | Authors: | Gurel, G, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2009-02-09 | | Release date: | 2009-04-28 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome.
J.Mol.Biol., 389, 2009
|
|
2GM5
 | | An activated, truncated gamma-delta resolvase tetramer | | Descriptor: | Transposon gamma-delta resolvase | | Authors: | Kamtekar, S, Ho, R.S, Li, W, Steitz, T.A. | | Deposit date: | 2006-04-05 | | Release date: | 2006-06-27 | | Last modified: | 2021-10-20 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Implications of structures of synaptic tetramers of gamma delta resolvase for the mechanism of recombination.
Proc.Natl.Acad.Sci.Usa, 103, 2006
|
|
3G4S
 | | Co-crystal structure of Tiamulin bound to the large ribosomal subunit | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10, 50S ribosomal protein L10e, ... | | Authors: | Gurel, G, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2009-02-04 | | Release date: | 2009-04-28 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome.
J.Mol.Biol., 389, 2009
|
|
3CMA
 | |
1G6N
 | | 2.1 ANGSTROM STRUCTURE OF CAP-CAMP | | Descriptor: | ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE, CATABOLITE GENE ACTIVATOR PROTEIN | | Authors: | Passner, J.M, Schultz, S.C, Steitz, T.A. | | Deposit date: | 2000-11-07 | | Release date: | 2000-12-15 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Modeling the cAMP-induced allosteric transition using the crystal structure of CAP-cAMP at 2.1 A resolution.
J.Mol.Biol., 304, 2000
|
|
3CPW
 | | The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3', 50S ribosomal protein L10E, ... | | Authors: | Ippolito, J.A, Kanyo, Z.K, Wang, D, Franceschi, F.J, Moore, P.B, Steitz, T.A, Duffy, E.M. | | Deposit date: | 2008-04-01 | | Release date: | 2008-07-22 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal Structure of the Oxazolidinone Antibiotic
Linezolid Bound to the 50S Ribosomal Subunit
J.Med.Chem., 51, 2008
|
|
1YIT
 | | Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-13 | | Release date: | 2005-04-26 | | Last modified: | 2024-07-10 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structures of Mlsbk Antibiotics Bound to Mutated Large Ribosomal Subunits Provide a Structural Explanation for Resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1REA
 | |
6VPQ
 | |
2PZS
 | | Phi29 DNA polymerase complexed with primer-template DNA (post-translocation binary complex) | | Descriptor: | 5'-d(CTAACACGTAAGCAGTC)-3', 5'-d(GACTGCTTAC)-3', DNA polymerase | | Authors: | Berman, A.J, Kamtekar, S, Goodman, J.L, Lazaro, J.M, de Vega, M, Blanco, L, Salas, M, Steitz, T.A. | | Deposit date: | 2007-05-18 | | Release date: | 2007-07-17 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structures of phi29 DNA polymerase complexed with substrate: the mechanism of translocation in B-family polymerases
Embo J., 26, 2007
|
|
2PY5
 | | Phi29 DNA polymerase complexed with single-stranded DNA | | Descriptor: | 1,2-ETHANEDIOL, 5'-d(GGACTTT)-3', DNA polymerase | | Authors: | Berman, A.J, Kamtekar, S, Goodman, J.L, Lazaro, J.M, de Vega, M, Blanco, L, Salas, M, Steitz, T.A. | | Deposit date: | 2007-05-15 | | Release date: | 2007-07-17 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Structures of phi29 DNA polymerase complexed with substrate: the mechanism of translocation in B-family polymerases
Embo J., 26, 2007
|
|
1KLN
 | | DNA POLYMERASE I KLENOW FRAGMENT (E.C.2.7.7.7) MUTANT/DNA COMPLEX | | Descriptor: | DNA (5'-D(*GP*CP*CP*GP*CP*GP*AP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*TP*CP*GP*CP*GP*GP*CP*GP*GP*C)-3'), PROTEIN (DNA POLYMERASE I KLENOW FRAGMENT (E.C.2.7.7.7)), ... | | Authors: | Beese, L.S, Derbyshire, V, Steitz, T.A. | | Deposit date: | 1994-05-24 | | Release date: | 1994-11-30 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structure of DNA polymerase I Klenow fragment bound to duplex DNA.
Science, 260, 1993
|
|
1QSL
 | |
