4V8G
 
 | | Crystal structure of RMF bound to the 70S ribosome. | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S Ribosomal Protein S10, ... | | Authors: | Polikanov, Y.S, Blaha, G.M, Steitz, T.A. | | Deposit date: | 2011-12-11 | | Release date: | 2014-07-09 | | Last modified: | 2014-12-10 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | How hibernation factors RMF, HPF, and YfiA turn off protein synthesis.
Science, 336, 2012
|
|
4V8A
 | | The structure of thermorubin in complex with the 70S ribosome from Thermus thermophilus. | | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Bulkley, D, Johnson, F.A, Steitz, T.A. | | Deposit date: | 2011-12-05 | | Release date: | 2014-07-09 | | Last modified: | 2014-12-10 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The antibiotic thermorubin inhibits protein synthesis by binding to inter-subunit bridge b2a of the ribosome.
J.Mol.Biol., 416, 2012
|
|
4W2E
 | | Crystal structure of Elongation Factor 4 (EF4/LepA) bound to the Thermus thermophilus 70S ribosome | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Gagnon, M.G, Lin, J, Steitz, T.A. | | Deposit date: | 2014-06-04 | | Release date: | 2014-10-01 | | Last modified: | 2023-07-26 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Crystal structure of elongation factor 4 bound to a clockwise ratcheted ribosome.
Science, 345, 2014
|
|
2R6D
 | | Crystal Form B1 | | Descriptor: | Replicative helicase | | Authors: | Bailey, S, Eliason, W.K, Steitz, T.A. | | Deposit date: | 2007-09-05 | | Release date: | 2008-06-10 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.7 Å) | | Cite: | Structure of hexameric DnaB helicase and its complex with a domain of DnaG primase
Science, 318, 2007
|
|
4WQF
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G and fusidic acid in the post-translocational state | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Lin, J, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2014-10-21 | | Release date: | 2015-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation.
Cell, 160, 2015
|
|
4WPO
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G in the pre-translocational state | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Lin, J, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2014-10-20 | | Release date: | 2015-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation.
Cell, 160, 2015
|
|
4WQU
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G trapped by the antibiotic dityromycin | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Lin, J, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2014-10-22 | | Release date: | 2015-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation.
Cell, 160, 2015
|
|
4WQY
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G in the post-translocational state (without fusitic acid) | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Lin, J, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2014-10-22 | | Release date: | 2015-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation.
Cell, 160, 2015
|
|
1GSG
 | | Structure of E.coli glutaminyl-tRNA synthetase complexed with trnagln and ATP at 2.8 Angstroms resolution | | Descriptor: | GLUTAMINYL-TRNA SYNTHETASE, TRNAGLN | | Authors: | Rould, M.A, Perona, J.J, Soell, D, Steitz, T.A. | | Deposit date: | 1990-04-03 | | Release date: | 1992-02-24 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structure of E. coli glutaminyl-tRNA synthetase complexed with tRNA(Gln) and ATP at 2.8 A resolution.
Science, 246, 1989
|
|
430D
 | | STRUCTURE OF SARCIN/RICIN LOOP FROM RAT 28S RRNA | | Descriptor: | MAGNESIUM ION, SARCIN/RICIN LOOP FROM RAT 28S R-RNA | | Authors: | Correll, C.C, Munishkin, A, Chan, Y.L, Ren, Z, Wool, I.G, Steitz, T.A. | | Deposit date: | 1998-10-04 | | Release date: | 1998-10-07 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Crystal structure of the ribosomal RNA domain essential for binding elongation factors.
Proc.Natl.Acad.Sci.USA, 95, 1998
|
|
3CFR
 | | Structure of the replicating complex of a POL Alpha family DNA Polymerase, ternary complex 2 | | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (5'-D(*DGP*DCP*DGP*DGP*DAP*DCP*DTP*DGP*DCP*DTP*DTP*DAP*(DOC))-3'), ... | | Authors: | Wang, J, Klimenko, D, Wang, M, Steitz, T.A, Konigsberg, W.H. | | Deposit date: | 2008-03-04 | | Release date: | 2009-03-10 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Insights into base selectivity from the structures
of an RB69 DNA Polymerase triple mutant
To be Published
|
|
2KZZ
 | | KLENOW FRAGMENT WITH NORMAL SUBSTRATE AND ZINC ONLY | | Descriptor: | DNA (5'-D(*GP*CP*TP*T*AP*CP*G)-3'), PROTEIN (DNA POLYMERASE I), ZINC ION | | Authors: | Brautigam, C.A, Sun, S, Piccirilli, J.A, Steitz, T.A. | | Deposit date: | 1998-07-07 | | Release date: | 1999-12-14 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | Structures of normal single-stranded DNA and deoxyribo-3'-S-phosphorothiolates bound to the 3'-5' exonucleolytic active site of DNA polymerase I from Escherichia coli.
Biochemistry, 38, 1999
|
|
1FFY
 | | INSIGHTS INTO EDITING FROM AN ILE-TRNA SYNTHETASE STRUCTURE WITH TRNA(ILE) AND MUPIROCIN | | Descriptor: | ISOLEUCYL-TRNA, ISOLEUCYL-TRNA SYNTHETASE, MAGNESIUM ION, ... | | Authors: | Silvian, L.F, Wang, J, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-07 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Insights into editing from an ile-tRNA synthetase structure with tRNAile and mupirocin.
Science, 285, 1999
|
|
5DOX
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with Hygromycin-A at 3.1A resolution | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Polikanov, Y.S, Starosta, A.L, Juette, M.F, Altman, R.B, Terry, D.S, Lu, W, Burnett, B.J, Dinos, G, Reynolds, K, Blanchard, S.C, Steitz, T.A, Wilson, D.N. | | Deposit date: | 2015-09-11 | | Release date: | 2015-12-30 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Distinct tRNA Accommodation Intermediates Observed on the Ribosome with the Antibiotics Hygromycin A and A201A.
Mol.Cell, 58, 2015
|
|
5DOY
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with antibiotic Hygromycin A, mRNA and three tRNAs in the A, P and E sites at 2.6A resolution | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S Ribosomal Protein S10, ... | | Authors: | Polikanov, Y.S, Starosta, A.L, Juette, M.F, Altman, R.B, Terry, D.S, Lu, W, Burnett, B.J, Dinos, G, Reynolds, K, Blanchard, S.C, Steitz, T.A, Wilson, D.N. | | Deposit date: | 2015-09-11 | | Release date: | 2015-12-30 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Distinct tRNA Accommodation Intermediates Observed on the Ribosome with the Antibiotics Hygromycin A and A201A.
Mol.Cell, 58, 2015
|
|
3NCI
 | | RB69 DNA Polymerase Ternary Complex with dCTP Opposite dG at 1.8 angstrom resolution | | Descriptor: | 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, CALCIUM ION, DNA (5'-D(*GP*CP*GP*GP*AP*CP*TP*GP*CP*TP*TP*AP*(DOC))-3'), ... | | Authors: | Wang, M, Blaha, G, Steitz, T.A, Konigsberg, W.H, Wang, J. | | Deposit date: | 2010-06-04 | | Release date: | 2011-02-02 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.79 Å) | | Cite: | Insights into base selectivity from the 1.8 A resolution structure of an RB69 DNA polymerase ternary complex.
Biochemistry, 50, 2011
|
|
2CGP
 | | CATABOLITE GENE ACTIVATOR PROTEIN/DNA COMPLEX, ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE | | Descriptor: | ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE, DNA (5'-D(*AP*TP*TP*AP*AP*TP*GP*TP*GP*AP*CP*AP*TP*AP*T)-3'), DNA (5'-D(*GP*TP*CP*AP*CP*AP*TP*TP*AP*AP*T)-3'), ... | | Authors: | Passner, J.M, Steitz, T.A. | | Deposit date: | 1997-01-31 | | Release date: | 1998-02-04 | | Last modified: | 2023-08-02 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | The structure of a CAP-DNA complex having two cAMP molecules bound to each monomer.
Proc.Natl.Acad.Sci.USA, 94, 1997
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1G6N
 | | 2.1 ANGSTROM STRUCTURE OF CAP-CAMP | | Descriptor: | ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE, CATABOLITE GENE ACTIVATOR PROTEIN | | Authors: | Passner, J.M, Schultz, S.C, Steitz, T.A. | | Deposit date: | 2000-11-07 | | Release date: | 2000-12-15 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Modeling the cAMP-induced allosteric transition using the crystal structure of CAP-cAMP at 2.1 A resolution.
J.Mol.Biol., 304, 2000
|
|
5HAU
 | | Crystal structure of antimicrobial peptide Bac7(1-19) bound to the Thermus thermophilus 70S ribosome | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Gagnon, M.G, Roy, R.N, Lomakin, I.B, Florin, T, Mankin, A.S, Steitz, T.A. | | Deposit date: | 2015-12-30 | | Release date: | 2016-04-06 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition.
Nucleic Acids Res., 44, 2016
|
|
5HCP
 | | Crystal structure of antimicrobial peptide Metalnikowin bound to the Thermus thermophilus 70S ribosome | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Gagnon, M.G, Roy, R.N, Lomakin, I.B, Florin, T, Mankin, A.S, Steitz, T.A. | | Deposit date: | 2016-01-04 | | Release date: | 2016-04-06 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.894 Å) | | Cite: | Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition.
Nucleic Acids Res., 44, 2016
|
|
5HCR
 | | Crystal structure of antimicrobial peptide Oncocin 10wt bound to the Thermus thermophilus 70S ribosome | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Gagnon, M.G, Roy, R.N, Lomakin, I.B, Florin, T, Mankin, A.S, Steitz, T.A. | | Deposit date: | 2016-01-04 | | Release date: | 2016-04-06 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition.
Nucleic Acids Res., 44, 2016
|
|
5HCQ
 | | Crystal structure of antimicrobial peptide Oncocin d15-19 bound to the Thermus thermophilus 70S ribosome | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Gagnon, M.G, Roy, R.N, Lomakin, I.B, Florin, T, Mankin, A.S, Steitz, T.A. | | Deposit date: | 2016-01-04 | | Release date: | 2016-04-06 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.801 Å) | | Cite: | Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition.
Nucleic Acids Res., 44, 2016
|
|
5HD1
 | | Crystal structure of antimicrobial peptide Pyrrhocoricin bound to the Thermus thermophilus 70S ribosome | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Gagnon, M.G, Roy, R.N, Lomakin, I.B, Florin, T, Mankin, A.S, Steitz, T.A. | | Deposit date: | 2016-01-04 | | Release date: | 2016-04-06 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition.
Nucleic Acids Res., 44, 2016
|
|
