1V16
 
 | | CROSSTALK BETWEEN COFACTOR BINDING AND THE PHOSPHORYLATION LOOP CONFORMATION IN THE BCKD MACHINE | | Descriptor: | 2-OXOISOVALERATE DEHYDROGENASE ALPHA SUBUNIT, 2-OXOISOVALERATE DEHYDROGENASE BETA SUBUNIT, BENZAMIDINE, ... | | Authors: | Li, J, Wynn, R.M, Machius, M, Chuang, J.L, Karthikeyan, S, Tomchick, D.R, Chuang, D.T. | | Deposit date: | 2004-04-07 | | Release date: | 2004-06-03 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Cross-Talk between Thiamin Diphosphate Binding and Phosphorylation Loop Conformation in Human Branched-Chain {Alpha}-Keto Acid Decarboxylase/Dehydrogenase
J.Biol.Chem., 279, 2004
|
|
1V6N
 | | Peanut lectin with 9mer peptide (PVIWSSATG) | | Descriptor: | CALCIUM ION, Galactose-binding lectin, MANGANESE (II) ION | | Authors: | Kundhavai Natchiar, S, Arockia Jeyaprakash, A, Ramya, T.N.C, Thomas, C.J, Suguna, K, Surolia, A, Vijayan, M. | | Deposit date: | 2003-12-02 | | Release date: | 2004-02-10 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (3.5 Å) | | Cite: | Structural plasticity of peanut lectin: an X-ray analysis involving variation in pH, ligand binding and crystal structure.
Acta Crystallogr.,Sect.D, 60, 2004
|
|
1V7M
 | | Human Thrombopoietin Functional Domain Complexed To Neutralizing Antibody TN1 Fab | | Descriptor: | Monoclonal TN1 Fab Heavy Chain, Monoclonal TN1 Fab Light Chain, Thrombopoietin | | Authors: | Feese, M.D, Tamada, T, Kato, Y, Maeda, Y, Hirose, M, Matsukura, Y, Shigematsu, H, Kato, T, Miyazaki, H, Kuroki, R. | | Deposit date: | 2003-12-18 | | Release date: | 2004-03-02 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (2.51 Å) | | Cite: | Structure of the receptor-binding domain of human thrombopoietin determined by complexation with a neutralizing antibody fragment
Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
7D54
 | | Crstal structure MsGATase with Gln | | Descriptor: | GLUTAMINE, Glutamine amidotransferase class-I | | Authors: | Chen, Y, Zhang, Q, Bartlam, M. | | Deposit date: | 2020-09-24 | | Release date: | 2021-10-06 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Structure and mechanism of the gamma-glutamyl-gamma-aminobutyrate hydrolase SpuA from Pseudomonas aeruginosa.
Acta Crystallogr D Struct Biol, 77, 2021
|
|
7KOD
 | | Cryo-EM structure of heavy chain mouse apoferritin | | Descriptor: | Ferritin heavy chain | | Authors: | Sun, M, Azumaya, C, Tse, E, Frost, A, Southworth, D, Verba, K.A, Cheng, Y, Agard, D.A. | | Deposit date: | 2020-11-08 | | Release date: | 2020-12-16 | | Last modified: | 2024-03-06 | | Method: | ELECTRON MICROSCOPY (1.655 Å) | | Cite: | Practical considerations for using K3 cameras in CDS mode for high-resolution and high-throughput single particle cryo-EM.
J.Struct.Biol., 213, 2021
|
|
7D4R
 | | SpuA native structure | | Descriptor: | MAGNESIUM ION, Probable glutamine amidotransferase | | Authors: | Chen, Y, Zhang, Q, Bartlam, M. | | Deposit date: | 2020-09-24 | | Release date: | 2021-10-06 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Structure and mechanism of the gamma-glutamyl-gamma-aminobutyrate hydrolase SpuA from Pseudomonas aeruginosa.
Acta Crystallogr D Struct Biol, 77, 2021
|
|
7DMO
 | |
7D50
 | | SpuA mutant - H221N with glutamyl-thioester | | Descriptor: | MAGNESIUM ION, Probable glutamine amidotransferase | | Authors: | Chen, Y, Zhang, Q, Bartlam, M. | | Deposit date: | 2020-09-24 | | Release date: | 2021-10-06 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.77 Å) | | Cite: | Structure and mechanism of the gamma-glutamyl-gamma-aminobutyrate hydrolase SpuA from Pseudomonas aeruginosa.
Acta Crystallogr D Struct Biol, 77, 2021
|
|
7KFF
 | | Crystal structure of TrmD tRNA (guanine-N1)-methyltransferase from Corynebacterium diphtheriae in complex with SAH | | Descriptor: | ACETATE ION, S-ADENOSYL-L-HOMOCYSTEINE, tRNA (guanine-N(1)-)-methyltransferase | | Authors: | Michalska, K, Tanase, L, Maltseva, N, Kim, Y, Endres, M, Joachimiak, A, Center for Structural Genomics of Infectious Diseases (CSGID) | | Deposit date: | 2020-10-13 | | Release date: | 2020-10-28 | | Method: | X-RAY DIFFRACTION (1.35 Å) | | Cite: | Crystal structure of TrmD tRNA (guanine-N1)-methyltransferase from Corynebacterium diphtheriae in complex with SAH
To Be Published
|
|
7DMN
 | | Crystal structure of two pericyclases catalyzing [4+2] cycloaddition | | Descriptor: | Diels-Alderase fsa2, GLYCEROL | | Authors: | Chi, C.B, Wang, Z.D, Liu, T, Zhang, Z.Y, Ma, M. | | Deposit date: | 2020-12-04 | | Release date: | 2021-10-06 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal Structures of Fsa2 and Phm7 Catalyzing [4 + 2] Cycloaddition Reactions with Reverse Stereoselectivities in Equisetin and Phomasetin Biosynthesis.
Acs Omega, 6, 2021
|
|
7D53
 | | SpuA mutant - H221N with Glu | | Descriptor: | GLUTAMIC ACID, MAGNESIUM ION, Probable glutamine amidotransferase | | Authors: | Chen, Y, Zhang, Q, Bartlam, M. | | Deposit date: | 2020-09-24 | | Release date: | 2021-10-06 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Structure and mechanism of the gamma-glutamyl-gamma-aminobutyrate hydrolase SpuA from Pseudomonas aeruginosa.
Acta Crystallogr D Struct Biol, 77, 2021
|
|
7DBT
 | | Crystal structure of catalytic domain of Anhydrobiosis-related Mn-dependent Peroxidase (AMNP) from Ramazzottius varieornatus (Mn2+-bound form) | | Descriptor: | AMNP/g12777, MANGANESE (II) ION | | Authors: | Yoshida, Y, Satoh, T, Ota, C, Tanaka, S, Horikawa, D.D, Tomita, M, Kato, K, Arakawa, K. | | Deposit date: | 2020-10-21 | | Release date: | 2021-10-06 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Time-series transcriptomic screening of factors contributing to the cross-tolerance to UV radiation and anhydrobiosis in tardigrades.
Bmc Genomics, 23, 2022
|
|
7DBU
 | | Crystal structure of catalytic domain of Anhydrobiosis-related Mn-dependent Peroxidase (AMNP) from Ramazzottius varieornatus (Zn2+-bound form) | | Descriptor: | AMNP/g12777, ZINC ION | | Authors: | Yoshida, Y, Satoh, T, Ota, C, Tanaka, S, Horikawa, D.D, Tomita, M, Kato, K, Arakawa, K. | | Deposit date: | 2020-10-21 | | Release date: | 2021-10-06 | | Last modified: | 2022-06-15 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Time-series transcriptomic screening of factors contributing to the cross-tolerance to UV radiation and anhydrobiosis in tardigrades.
Bmc Genomics, 23, 2022
|
|
7DT8
 | |
7D5Z
 | | Crystal structure of EBV gH/gL bound with neutralizing antibody 1D8 | | Descriptor: | Envelope glycoprotein H, Envelope glycoprotein L, heavy chain of 1D8, ... | | Authors: | Zhu, Q, Shan, S, Yu, J, Wang, X, Zhang, L, Zeng, M. | | Deposit date: | 2020-09-28 | | Release date: | 2021-10-20 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (4.2 Å) | | Cite: | A Neutralizing Antibody Targeting a New Site of Vulnerability on Epstein-Barr Virus gH/gL Protects against Dual-Tropic Infection
To Be Published
|
|
7KSL
 | | Substrate-free human mitochondrial LONP1 | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Lon protease homolog, mitochondrial | | Authors: | Shin, M, Watson, E.R, Song, A.S, Mindrebo, J.T, Novick, S.R, Griffin, P, Wiseman, R.L, Lander, G.C. | | Deposit date: | 2020-11-23 | | Release date: | 2020-12-09 | | Last modified: | 2024-05-29 | | Method: | ELECTRON MICROSCOPY (3.5 Å) | | Cite: | Structures of the human LONP1 protease reveal regulatory steps involved in protease activation.
Nat Commun, 12, 2021
|
|
5RE6
 | | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with Z54571979 | | Descriptor: | 3C-like proteinase, DIMETHYL SULFOXIDE, N-{4-[(pyrimidin-2-yl)oxy]phenyl}acetamide | | Authors: | Fearon, D, Owen, C.D, Douangamath, A, Lukacik, P, Powell, A.J, Strain-Damerell, C.M, Resnick, E, Krojer, T, Gehrtz, P, Wild, C, Aimon, A, Brandao-Neto, J, Carbery, A, Dunnett, L, Skyner, R, Snee, M, London, N, Walsh, M.A, von Delft, F. | | Deposit date: | 2020-03-15 | | Release date: | 2020-03-25 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (1.87 Å) | | Cite: | Crystallographic and electrophilic fragment screening of the SARS-CoV-2 main protease.
Nat Commun, 11, 2020
|
|
5REM
 | | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0103016 | | Descriptor: | 1 1-(4-(2-nitrophenyl)piperazin-1-yl)ethan-1-one, 3C-like proteinase, DIMETHYL SULFOXIDE | | Authors: | Fearon, D, Owen, C.D, Douangamath, A, Lukacik, P, Powell, A.J, Strain-Damerell, C.M, Resnick, E, Krojer, T, Gehrtz, P, Wild, C, Aimon, A, Brandao-Neto, J, Carbery, A, Dunnett, L, Skyner, R, Snee, M, London, N, Walsh, M.A, von Delft, F. | | Deposit date: | 2020-03-15 | | Release date: | 2020-03-25 | | Last modified: | 2021-02-24 | | Method: | X-RAY DIFFRACTION (1.96 Å) | | Cite: | Crystallographic and electrophilic fragment screening of the SARS-CoV-2 main protease.
Nat Commun, 11, 2020
|
|
5RF3
 | | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with Z1741970824 | | Descriptor: | 3C-like proteinase, DIMETHYL SULFOXIDE, pyrimidin-5-amine | | Authors: | Fearon, D, Owen, C.D, Douangamath, A, Lukacik, P, Powell, A.J, Strain-Damerell, C.M, Resnick, E, Krojer, T, Gehrtz, P, Wild, C, Aimon, A, Brandao-Neto, J, Carbery, A, Dunnett, L, Skyner, R, Snee, M, London, N, Walsh, M.A, von Delft, F. | | Deposit date: | 2020-03-15 | | Release date: | 2020-03-25 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Crystallographic and electrophilic fragment screening of the SARS-CoV-2 main protease.
Nat Commun, 11, 2020
|
|
7KSC
 | | Crystal structure of Pun g 1.0101 | | Descriptor: | Non-specific lipid-transfer protein, SULFATE ION | | Authors: | Pote, S, O'Malley, A, Gawlicka-Chruszcz, A, Tuppo, L, Ciardiello, M.A, Chruszcz, M. | | Deposit date: | 2020-11-21 | | Release date: | 2021-01-20 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structural Characterization of Act c 10.0101 and Pun g 1.0101-Allergens from the Non-Specific Lipid Transfer Protein Family.
Molecules, 26, 2021
|
|
5RED
 | | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with Z2856434865 | | Descriptor: | 3C-like proteinase, 4-[2-(phenylsulfanyl)ethyl]morpholine, DIMETHYL SULFOXIDE | | Authors: | Fearon, D, Owen, C.D, Douangamath, A, Lukacik, P, Powell, A.J, Strain-Damerell, C.M, Resnick, E, Krojer, T, Gehrtz, P, Wild, C, Aimon, A, Brandao-Neto, J, Carbery, A, Dunnett, L, Skyner, R, Snee, M, London, N, Walsh, M.A, von Delft, F. | | Deposit date: | 2020-03-15 | | Release date: | 2020-03-25 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (1.47 Å) | | Cite: | Crystallographic and electrophilic fragment screening of the SARS-CoV-2 main protease.
Nat Commun, 11, 2020
|
|
5REW
 | | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102275 | | Descriptor: | 3C-like proteinase, DIMETHYL SULFOXIDE, N-[(1R)-1-(naphthalen-1-yl)ethyl]acetamide | | Authors: | Fearon, D, Owen, C.D, Douangamath, A, Lukacik, P, Powell, A.J, Strain-Damerell, C.M, Resnick, E, Krojer, T, Gehrtz, P, Wild, C, Aimon, A, Brandao-Neto, J, Carbery, A, Dunnett, L, Skyner, R, Snee, M, London, N, Walsh, M.A, von Delft, F. | | Deposit date: | 2020-03-15 | | Release date: | 2020-03-25 | | Last modified: | 2021-02-24 | | Method: | X-RAY DIFFRACTION (1.55 Å) | | Cite: | Crystallographic and electrophilic fragment screening of the SARS-CoV-2 main protease.
Nat Commun, 11, 2020
|
|
5RFJ
 | | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0103067 | | Descriptor: | 3C-like proteinase, DIMETHYL SULFOXIDE, N-(4-methoxy-1,3-benzothiazol-2-yl)acetamide | | Authors: | Fearon, D, Owen, C.D, Douangamath, A, Lukacik, P, Powell, A.J, Strain-Damerell, C.M, Resnick, E, Krojer, T, Gehrtz, P, Wild, C, Aimon, A, Brandao-Neto, J, Carbery, A, Dunnett, L, Skyner, R, Snee, M, London, N, Walsh, M.A, von Delft, F. | | Deposit date: | 2020-03-15 | | Release date: | 2020-03-25 | | Last modified: | 2021-02-24 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Crystallographic and electrophilic fragment screening of the SARS-CoV-2 main protease.
Nat Commun, 11, 2020
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
5RF5
 | | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with Z3241250482 | | Descriptor: | 1,1-bis(oxidanylidene)thietan-3-ol, 3C-like proteinase, DIMETHYL SULFOXIDE | | Authors: | Fearon, D, Owen, C.D, Douangamath, A, Lukacik, P, Powell, A.J, Strain-Damerell, C.M, Resnick, E, Krojer, T, Gehrtz, P, Wild, C, Aimon, A, Brandao-Neto, J, Carbery, A, Dunnett, L, Skyner, R, Snee, M, London, N, Walsh, M.A, von Delft, F. | | Deposit date: | 2020-03-15 | | Release date: | 2020-03-25 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (1.74 Å) | | Cite: | Crystallographic and electrophilic fragment screening of the SARS-CoV-2 main protease.
Nat Commun, 11, 2020
|
|
