1QWA
 
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
1QWB
 | |
5FV7
 | | Human Fen1 in complex with an N-hydroxyurea compound | | Descriptor: | 1-[(2S)-2,3-dihydro-1,4-benzodioxin-2-ylmethyl]-3-hydroxythieno[3,2-d]pyrimidine-2,4(1H,3H)-dione, FLAP ENDONUCLEASE 1, MAGNESIUM ION | | Authors: | Exell, J.C, Thompson, M.J, Finger, L.D, Shaw, S.K, Abbott, W.M, McWhirter, C, Debreczeni, J.E, Jones, C.D, Nissink, J.W.M, Ward, T.A, Sioberg, C.W.L, Molina, D.M, Durant, S.T, Grasby, J.A. | | Deposit date: | 2016-02-03 | | Release date: | 2016-08-17 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.84 Å) | | Cite: | Cellular Active N-Hydroxyurea Fen1 Inhibitors Block Substrate Entry to the Active Site
Nat.Chem.Biol., 12, 2016
|
|
1Q75
 | |
1IE2
 | | Solution Structure of an In Vitro Selected RNA which is Sequence Specifically Recognized by RBD12 of Hamster Nucleolin.sNRE (anti) | | Descriptor: | 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*CP*GP*AP*AP*GP*UP*AP*GP*GP*CP*C)-3' | | Authors: | Bouvet, P, Allain, F.H.-T, Finger, L.D, Dieckmann, T, Feigon, J. | | Deposit date: | 2001-04-05 | | Release date: | 2001-06-20 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Recognition of pre-formed and flexible elements of an RNA stem-loop by nucleolin.
J.Mol.Biol., 309, 2001
|
|
1IE1
 | | NMR Solution Structure of an In Vitro Selected RNA which is Sequence Specifically Recognized by Hamster Nucleolin RBD12. | | Descriptor: | 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*CP*GP*AP*AP*GP*UP*AP*GP*GP*CP*C)-3' | | Authors: | Bouvet, P, Allain, F.H.-T, Finger, L.D, Dieckmann, T, Feigon, J. | | Deposit date: | 2001-04-05 | | Release date: | 2001-06-20 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Recognition of pre-formed and flexible elements of an RNA stem-loop by nucleolin.
J.Mol.Biol., 309, 2001
|
|
1NA2
 | |
1RKJ
 | | Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target | | Descriptor: | 5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*GP*AP*GP*UP*GP*CP*AP*UP*CP*C)-3', Nucleolin | | Authors: | Johansson, C, Finger, L.D, Trantirek, L, Mueller, T.D, Kim, S, Laird-Offringa, I.A, Feigon, J. | | Deposit date: | 2003-11-21 | | Release date: | 2004-04-27 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target.
J.Mol.Biol., 337, 2004
|
|
