8IKA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8ika by Molmil](/molmil-images/mine/8ika) | |
2AXY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2axy by Molmil](/molmil-images/mine/2axy) | Crystal Structure of KH1 domain of human Poly(C)-binding protein-2 with C-rich strand of human telomeric DNA | Descriptor: | C-rich strand of human telomeric dna, Poly(rC)-binding protein 2 | Authors: | Du, Z, Lee, J.K, Tjhen, R.J, Li, S, Stroud, R.M, James, T.L. | Deposit date: | 2005-09-06 | Release date: | 2005-09-27 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Crystal Structure of the First KH Domain of Human Poly(C)-binding Protein-2 in Complex with a C-rich Strand of Human Telomeric DNA at 1.7 A J.Biol.Chem., 280, 2005
|
|
1R7Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1r7z by Molmil](/molmil-images/mine/1r7z) | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1R7W
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1r7w by Molmil](/molmil-images/mine/1r7w) | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1ROQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1roq by Molmil](/molmil-images/mine/1roq) | |
1TXS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1txs by Molmil](/molmil-images/mine/1txs) | STEM-LOOP D OF THE CLOVERLEAF DOMAIN OF ENTEROVIRAL 5'UTR RNA | Descriptor: | Enteroviral 5'-UTR | Authors: | Du, Z, Yu, J, Ulyanov, N.B, Andino, R, James, T.L. | Deposit date: | 2004-07-06 | Release date: | 2004-10-05 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution Structure of a Consensus Stem-Loop D RNA Domain that Plays Important Roles in Regulating Translation and Replication in Enteroviruses and Rhinoviruses Biochemistry, 43, 2004
|
|
2JZX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2jzx by Molmil](/molmil-images/mine/2jzx) | PCBP2 KH1-KH2 domains | Descriptor: | Poly(rC)-binding protein 2 | Authors: | Du, Z, Fenn, S, Tjhen, R, James, T. | Deposit date: | 2008-01-21 | Release date: | 2008-08-12 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Structure of the first and second KH domains of human poly-C binding protein-2 reveals insights into its regulatory mechanisms To be Published
|
|
2L8L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2l8l by Molmil](/molmil-images/mine/2l8l) | |
8GS8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8gs8 by Molmil](/molmil-images/mine/8gs8) | cryo-EM structure of the human respiratory complex II | Descriptor: | (1S)-2-{[(2-AMINOETHOXY)(HYDROXY)PHOSPHORYL]OXY}-1-[(PALMITOYLOXY)METHYL]ETHYL STEARATE, FE2/S2 (INORGANIC) CLUSTER, FE3-S4 CLUSTER, ... | Authors: | Du, Z, Zhou, X, Lai, Y, Xu, J, Zhang, Y, Zhou, S, Liu, F, Gao, Y, Gong, H, Rao, Z. | Deposit date: | 2022-09-05 | Release date: | 2023-05-10 | Last modified: | 2024-07-03 | Method: | ELECTRON MICROSCOPY (2.86 Å) | Cite: | Structure of the human respiratory complex II. Proc.Natl.Acad.Sci.USA, 120, 2023
|
|
4HNM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4hnm by Molmil](/molmil-images/mine/4hnm) | Crystal structure of human catenin-beta-like 1 56 kDa fragment | Descriptor: | Beta-catenin-like protein 1 | Authors: | Du, Z, Huang, X, Wang, G, Wu, Y. | Deposit date: | 2012-10-19 | Release date: | 2013-07-31 | Last modified: | 2013-08-21 | Method: | X-RAY DIFFRACTION (2.9001 Å) | Cite: | The structure of full-length human CTNNBL1 reveals a distinct member of the armadillo-repeat protein family. Acta Crystallogr.,Sect.D, 69, 2013
|
|
4HM9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4hm9 by Molmil](/molmil-images/mine/4hm9) | Crystal structure of full-length human catenin-beta-like 1 | Descriptor: | Beta-catenin-like protein 1 | Authors: | Du, Z, Huang, X, Wang, G, Wu, Y. | Deposit date: | 2012-10-18 | Release date: | 2013-07-31 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (3.1001 Å) | Cite: | The structure of full-length human CTNNBL1 reveals a distinct member of the armadillo-repeat protein family. Acta Crystallogr.,Sect.D, 69, 2013
|
|
4L9C
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4l9c by Molmil](/molmil-images/mine/4l9c) | Crystal structure of the FP domain of human F-box protein Fbxo7 (native) | Descriptor: | F-box only protein 7, GLYCEROL | Authors: | Du, Z, Huang, X, Shang, J, Yang, Y, Wang, G. | Deposit date: | 2013-06-18 | Release date: | 2014-01-15 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Structure of the FP domain of Fbxo7 reveals a novel mode of protein-protein interaction. Acta Crystallogr.,Sect.D, 70, 2014
|
|
4L9H
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4l9h by Molmil](/molmil-images/mine/4l9h) | Crystal structure of the FP domain of human F-box protein Fbxo7(SeMet) | Descriptor: | F-box only protein 7 | Authors: | Du, Z, Huang, X, Shang, J, Yang, Y, Wang, G. | Deposit date: | 2013-06-18 | Release date: | 2014-01-15 | Last modified: | 2014-10-08 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Structure of the FP domain of Fbxo7 reveals a novel mode of protein-protein interaction. Acta Crystallogr.,Sect.D, 70, 2014
|
|
1LVJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1lvj by Molmil](/molmil-images/mine/1lvj) | |
2TPK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2tpk by Molmil](/molmil-images/mine/2tpk) | |
7YTJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7ytj by Molmil](/molmil-images/mine/7ytj) | Cryo-EM structure of VTC complex | Descriptor: | 1,2-DIACYL-SN-GLYCERO-3-PHOSPHOCHOLINE, INOSITOL HEXAKISPHOSPHATE, PHOSPHATE ION, ... | Authors: | Guan, Z.Y, Chen, J, Liu, R.W, Chen, Y.K, Xing, Q, Du, Z.M, Liu, Z. | Deposit date: | 2022-08-15 | Release date: | 2023-02-22 | Last modified: | 2024-07-03 | Method: | ELECTRON MICROSCOPY (3 Å) | Cite: | The cytoplasmic synthesis and coupled membrane translocation of eukaryotic polyphosphate by signal-activated VTC complex. Nat Commun, 14, 2023
|
|
4WBE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4wbe by Molmil](/molmil-images/mine/4wbe) | |
4WBP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4wbp by Molmil](/molmil-images/mine/4wbp) | |
1GMY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1gmy by Molmil](/molmil-images/mine/1gmy) | Cathepsin B complexed with dipeptidyl nitrile inhibitor | Descriptor: | 2-AMINOETHANIMIDIC ACID, 3-METHYLPHENYLALANINE, CATHEPSIN B, ... | Authors: | Greenspan, P.D, Clark, K.L, Tommasi, R.A, Cowen, S.D, McQuire, L.W, Farley, D.L, van Duzer, J.H, Goldberg, R.L, Zhou, H, Du, Z, Fitt, J.J, Coppa, D.E, Fang, Z, Macchia, W, Zhu, L, Capparelli, M.P, Goldstein, R, Wigg, A.M, Doughty, J.R, Bohacek, R.S, Knap, A.K. | Deposit date: | 2001-09-25 | Release date: | 2002-09-19 | Last modified: | 2017-07-05 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Identification of Dipeptidyl Nitriles as Potent and Selective Inhibitors of Cathepsin B Through Structure-Based Drug Design J.Med.Chem., 44, 2001
|
|
3C4B
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3c4b by Molmil](/molmil-images/mine/3c4b) | Structure of RNaseIIIb and dsRNA binding domains of mouse Dicer | Descriptor: | Endoribonuclease Dicer | Authors: | Lee, J.K, Du, Z, Tjhen, R.J, Stroud, R.M, James, T.L. | Deposit date: | 2008-01-29 | Release date: | 2008-02-19 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (1.68 Å) | Cite: | Structural and biochemical insights into the dicing mechanism of mouse Dicer: A conserved lysine is critical for dsRNA cleavage. Proc.Natl.Acad.Sci.Usa, 105, 2008
|
|
3C4T
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3c4t by Molmil](/molmil-images/mine/3c4t) | Structure of RNaseIIIb and dsRNA binding domains of mouse Dicer | Descriptor: | CADMIUM ION, Endoribonuclease Dicer | Authors: | Lee, J.K, Du, Z, Tjhen, R.J, Stroud, R.M, James, T.L. | Deposit date: | 2008-01-30 | Release date: | 2008-02-19 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Structural and biochemical insights into the dicing mechanism of mouse Dicer: A conserved lysine is critical for dsRNA cleavage. Proc.Natl.Acad.Sci.Usa, 105, 2008
|
|
5J97
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5j97 by Molmil](/molmil-images/mine/5j97) | |
2GM0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2gm0 by Molmil](/molmil-images/mine/2gm0) | Linear dimer of stemloop SL1 from HIV-1 | Descriptor: | RNA (35-MER) | Authors: | Ulyanov, N.B, Mujeeb, A, Du, Z, Tonelli, M, Parslow, T.G, James, T.L. | Deposit date: | 2006-04-05 | Release date: | 2006-04-25 | Last modified: | 2024-05-29 | Method: | SOLUTION NMR | Cite: | NMR Structure of the Full-length Linear Dimer of Stem-Loop-1 RNA in the HIV-1 Dimer Initiation Site. J.Biol.Chem., 281, 2006
|
|
2P2R
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2p2r by Molmil](/molmil-images/mine/2p2r) | Crystal structure of the third KH domain of human Poly(C)-Binding Protein-2 in complex with C-rich strand of human telomeric DNA | Descriptor: | 6-AMINOPYRIMIDIN-2(1H)-ONE, C-rich strand of human telomeric DNA, Poly(rC)-binding protein 2 | Authors: | James, T.L, Stroud, R.M, Du, Z, Fenn, S, Tjhen, R, Lee, J.K. | Deposit date: | 2007-03-07 | Release date: | 2007-06-12 | Last modified: | 2019-07-24 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Crystal structure of the third KH domain of human poly(C)-binding protein-2 in complex with a C-rich strand of human telomeric DNA at 1.6 A resolution. Nucleic Acids Res., 35, 2007
|
|
2PY9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2py9 by Molmil](/molmil-images/mine/2py9) | |