1KX5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx5 by Molmil](/molmil-images/mine/1kx5) | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx4 by Molmil](/molmil-images/mine/1kx4) | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx3 by Molmil](/molmil-images/mine/1kx3) | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
7COW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7cow by Molmil](/molmil-images/mine/7cow) | 353 bp di-nucleosome harboring cohesive DNA termini with linker histone H1.0 | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (353-MER), ... | Authors: | Adhireksan, Z, Sharma, D, Lee, P.L, Davey, C.A. | Deposit date: | 2020-08-05 | Release date: | 2021-08-11 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.86 Å) | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies. Nucleic Acids Res., 49, 2021
|
|
3UTB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3utb by Molmil](/molmil-images/mine/3utb) | Crystal Structure of Nucleosome Core Particle Assembled with the 146b Alpha-Satellite Sequence (NCP146b) | Descriptor: | 146-mer DNA, Histone H2A, Histone H2B 1.1, ... | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | Deposit date: | 2011-11-25 | Release date: | 2012-04-11 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome Nucleic Acids Res., 40, 2012
|
|
8YTI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8yti by Molmil](/molmil-images/mine/8yti) | Crystal Structure of Nucleosome-H1x Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (169-MER), ... | Authors: | Adhireksan, Z, Qiuye, B, Padavattan, S, Davey, C.A. | Deposit date: | 2024-03-26 | Release date: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Linker Histones Associate Heterogeneously with Nucleosomes in the Condensed State To Be Published
|
|
3LJA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3lja by Molmil](/molmil-images/mine/3lja) | |
3LEL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3lel by Molmil](/molmil-images/mine/3lel) | Structural Insight into the Sequence-Dependence of Nucleosome Positioning | Descriptor: | 147-MER DNA, Histone H2A, Histone H2B 1.1, ... | Authors: | Wu, B, Vasudevan, D, Davey, C.A. | Deposit date: | 2010-01-15 | Release date: | 2010-05-19 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.95 Å) | Cite: | Structural insight into the sequence dependence of nucleosome positioning Structure, 18, 2010
|
|
3B6F
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3b6f by Molmil](/molmil-images/mine/3b6f) | |
3B6G
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3b6g by Molmil](/molmil-images/mine/3b6g) | |
8QKT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8qkt by Molmil](/molmil-images/mine/8qkt) | |
5XF3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xf3 by Molmil](/molmil-images/mine/5xf3) | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (R,R-configuration) | Descriptor: | (1R,2R)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
5XF5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xf5 by Molmil](/molmil-images/mine/5xf5) | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (R,S-configuration) | Descriptor: | (1S,2R)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.82 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
5XF6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xf6 by Molmil](/molmil-images/mine/5xf6) | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having an ethylenediamine linker | Descriptor: | DNA (145-MER), ETHANE-1,2-DIAMINE, Histone H2A, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.63 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
5XF4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xf4 by Molmil](/molmil-images/mine/5xf4) | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (S,S-configuration) | Descriptor: | (1S,2S)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.87 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
7XX6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7xx6 by Molmil](/molmil-images/mine/7xx6) | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, DNA (169-MER), Histone H1.0, ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-28 | Release date: | 2023-05-31 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (3.39 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) To Be Published
|
|
7XVM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7xvm by Molmil](/molmil-images/mine/7xvm) | Crystal Structure of Nucleosome-H5 Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (169-MER), ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-24 | Release date: | 2023-05-24 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.84 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) To Be Published
|
|
7XX5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7xx5 by Molmil](/molmil-images/mine/7xx5) | Crystal Structure of Nucleosome-H1.3 Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, DNA (169-MER), Histone H1.3, ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-28 | Release date: | 2023-05-31 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (3.19 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) To Be Published
|
|
1M41
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1m41 by Molmil](/molmil-images/mine/1m41) | Crystal structure of Escherichia coli alkanesulfonate monooxygenase SsuD at 2.3 A resolution | Descriptor: | FMNH2-dependent alkanesulfonate monooxygenase | Authors: | Eichhorn, E, Davey, C.A, Sargent, D.F, Leisinger, T, Richmond, T.J. | Deposit date: | 2002-07-02 | Release date: | 2002-12-11 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Crystal Structure of Escherichia coli Alkanesulfonate Monooxygenase SsuD J.mol.biol., 324, 2002
|
|
7XVL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7xvl by Molmil](/molmil-images/mine/7xvl) | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169an DNA fragment) | Descriptor: | DNA (169-MER), Histone H1.0, Histone H2A type 1-B/E, ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-24 | Release date: | 2023-05-24 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (3.506 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169an DNA fragment) To Be Published
|
|
6IQ4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6iq4 by Molmil](/molmil-images/mine/6iq4) | Nucleosome core particle cross-linked with a hetero-binuclear molecule possessing RAPTA and gold(I) 4-(diphenylphosphino)benzoic acid groups. | Descriptor: | 4-diphenylphosphanylbenzoic acid, DNA (145-MER), GOLD ION, ... | Authors: | DeFalco, L, Batchelor, L.K, Adhireksan, Z, Dyson, P.J, Davey, C.A. | Deposit date: | 2018-11-06 | Release date: | 2019-10-30 | Last modified: | 2024-03-27 | Method: | X-RAY DIFFRACTION (2.25 Å) | Cite: | Crosslinking Allosteric Sites on the Nucleosome. Angew.Chem.Int.Ed.Engl., 58, 2019
|
|
6IPU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6ipu by Molmil](/molmil-images/mine/6ipu) | |
6JXD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6jxd by Molmil](/molmil-images/mine/6jxd) | |
6K1I
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6k1i by Molmil](/molmil-images/mine/6k1i) | Human nucleosome core particle with gammaH2A.X variant | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2AX, ... | Authors: | Sharma, D, De Falco, L, Davey, C.A. | Deposit date: | 2019-05-10 | Release date: | 2020-01-15 | Last modified: | 2024-03-27 | Method: | X-RAY DIFFRACTION (2.75 Å) | Cite: | PARP1 exhibits enhanced association and catalytic efficiency with gamma H2A.X-nucleosome. Nat Commun, 10, 2019
|
|
6K1K
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6k1k by Molmil](/molmil-images/mine/6k1k) | Human nucleosome core particle with H2A.X S139E variant | Descriptor: | CHLORIDE ION, DNA (145-MER), Histone H2AX, ... | Authors: | Sharma, D, De Falco, L, Davey, C.A. | Deposit date: | 2019-05-10 | Release date: | 2020-01-15 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | PARP1 exhibits enhanced association and catalytic efficiency with gamma H2A.X-nucleosome. Nat Commun, 10, 2019
|
|