3G3V
 
 | | Crystal structure of spin labeled T4 Lysozyme (V131R1) at 291 K | | Descriptor: | 2-HYDROXYETHYL DISULFIDE, AZIDE ION, CHLORIDE ION, ... | | Authors: | Fleissner, M.R, Cascio, D, Hubbell, W.L. | | Deposit date: | 2009-02-02 | | Release date: | 2009-05-05 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Structural origin of weakly ordered nitroxide motion in spin-labeled proteins.
Protein Sci., 18, 2009
|
|
5EJL
 | | MrkH, A novel c-di-GMP dependence transcription regulatory factor. | | Descriptor: | 1,2-ETHANEDIOL, 9,9'-[(2R,3R,3aS,5S,7aR,9R,10R,10aS,12S,14aR)-3,5,10,12-tetrahydroxy-5,12-dioxidooctahydro-2H,7H-difuro[3,2-d:3',2'-j][1,3,7,9,2,8]tetraoxadiphosphacyclododecine-2,9-diyl]bis(2-amino-1,9-dihydro-6H-purin-6-one), Klebsiella pneumoniae genome assembly NOVST, ... | | Authors: | Wang, F, Zhu, D, Gu, L. | | Deposit date: | 2015-11-02 | | Release date: | 2016-10-19 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | The PilZ domain of MrkH represents a novel DNA binding motif
Protein Cell, 7, 2016
|
|
6SW8
 | | Crystal structure of the NS1 (H7N1) RNA-binding domain | | Descriptor: | 1,2-ETHANEDIOL, DI(HYDROXYETHYL)ETHER, Non-structural protein 1 | | Authors: | Coste, F, Wacquiez, A, Marc, D, Castaing, B. | | Deposit date: | 2019-09-20 | | Release date: | 2020-10-07 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.933 Å) | | Cite: | Structure and Sequence Determinants Governing the Interactions of RNAs with Influenza A Virus Non-Structural Protein NS1.
Viruses, 12, 2020
|
|
5ELC
 | | Cholera toxin El Tor B-pentamer in complex with Lewis-y | | Descriptor: | BICINE, CALCIUM ION, Cholera enterotoxin subunit B, ... | | Authors: | Heggelund, J.E, Burschowsky, D, Krengel, U. | | Deposit date: | 2015-11-04 | | Release date: | 2016-03-30 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | High-Resolution Crystal Structures Elucidate the Molecular Basis of Cholera Blood Group Dependence.
Plos Pathog., 12, 2016
|
|
1URQ
 | | Crystal structure of neuronal Q-SNAREs in complex with R-SNARE motif of Tomosyn | | Descriptor: | M-TOMOSYN ISOFORM, SYNAPTOSOMAL-ASSOCIATED PROTEIN 25, SYNTAXIN 1A | | Authors: | Pobbati, A, Razeto, A, Becker, S, Fasshauer, D. | | Deposit date: | 2003-10-31 | | Release date: | 2004-08-26 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Structural Basis for the Inhibitory Role of Tomosyn in Exocytosis
J.Biol.Chem., 279, 2004
|
|
5D4L
 | | Structure of the apo form of CPII from Thiomonas intermedia K12, a nitrogen regulatory PII-like protein | | Descriptor: | Nitrogen regulatory protein P-II | | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | | Deposit date: | 2015-08-08 | | Release date: | 2016-09-28 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein.
J.Mol.Biol., 428, 2016
|
|
1UXE
 | | ADENOVIRUS AD37 FIBRE HEAD | | Descriptor: | ACETATE ION, FIBER PROTEIN, ZINC ION | | Authors: | Burmeister, W.P, Guilligay, D, Cusack, S, Wadell, G, Arnberg, N. | | Deposit date: | 2004-02-24 | | Release date: | 2004-07-02 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal Structure of Species D Adenovirus Fiber Knobs and Their Sialic Acid Binding Sites
J.Virol., 78, 2004
|
|
3M2N
 | | Crystal structure of human carbonic anhydrase isozyme II with 4-{2-[N-(6-chloro-5-nitropyrimidin-4-yl)amino]ethyl}benzenesulfonamide | | Descriptor: | 4-{2-[(6-chloro-5-nitropyrimidin-4-yl)amino]ethyl}benzenesulfonamide, BICINE, Carbonic anhydrase 2, ... | | Authors: | Grazulis, S, Manakova, E, Golovenko, D. | | Deposit date: | 2010-03-08 | | Release date: | 2011-02-16 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (1.65 Å) | | Cite: | Design of [(2-pyrimidinylthio)acetyl]benzenesulfonamides as inhibitors of human carbonic anhydrases.
Eur.J.Med.Chem., 51, 2012
|
|
1UTH
 | | DntR from Burkholderia sp. strain DNT in complex with Thiocyanate | | Descriptor: | LYSR-TYPE REGULATORY PROTEIN, THIOCYANATE ION | | Authors: | Smirnova, I.A, Dian, C, Leonard, G.A, McSweeney, S, Birse, D, Brzezinski, P. | | Deposit date: | 2003-12-09 | | Release date: | 2004-07-01 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Development of a Bacterial Biosensor for Nitrotoluenes: The Crystal Structure of the Transcriptional Regulator Dntr
J.Mol.Biol., 340, 2004
|
|
5D6S
 | | Structure of epoxyqueuosine reductase from Streptococcus thermophilus. | | Descriptor: | COBALAMIN, Epoxyqueuosine reductase, IRON/SULFUR CLUSTER | | Authors: | Payne, K.A.P, Fisher, K, Dunstan, M.S, Sjuts, H, Leys, D. | | Deposit date: | 2015-08-12 | | Release date: | 2015-09-23 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Epoxyqueuosine Reductase Structure Suggests a Mechanism for Cobalamin-dependent tRNA Modification.
J.Biol.Chem., 290, 2015
|
|
1UZ2
 | | The Cys121Ser Mutant of Beta-Lactoglobulin | | Descriptor: | BETA-LACTOGLOBULIN | | Authors: | McNae, I, Jayat, D, Haertle, T, Holt, C, Sawyer, L. | | Deposit date: | 2004-03-03 | | Release date: | 2004-05-20 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.95 Å) | | Cite: | A recombinant C121S mutant of bovine beta-lactoglobulin is more susceptible to peptic digestion and to denaturation by reducing agents and heating.
Biochemistry, 43, 2004
|
|
1UUZ
 | | IVY:A NEW FAMILY OF PROTEIN | | Descriptor: | INHIBITOR OF VERTEBRATE LYSOZYME, LYSOZYME C | | Authors: | Abergel, C, Lembo, F, Byrne, D, Maza, C, Claverie, J.M. | | Deposit date: | 2004-01-12 | | Release date: | 2004-01-14 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Structure and Evolution of the Ivy Protein Family, Unexpected Lysozyme Inhibitors in Gram-Negative Bacteria.
Proc.Natl.Acad.Sci.USA, 104, 2007
|
|
5D8I
 | |
1UPR
 | | Crystal structure of the PEPP1 pleckstrin homology domain in complex with Inositol 1,3,4,5-tetrakisphosphate | | Descriptor: | INOSITOL-(1,3,4,5)-TETRAKISPHOSPHATE, PLECKSTRIN HOMOLOGY DOMAIN-CONTAINING FAMILY A MEMBER 4 | | Authors: | Milburn, C.C, Komander, D, Deak, M, Alessi, D.R, Van Aalten, D.M.F. | | Deposit date: | 2003-10-10 | | Release date: | 2004-10-20 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.27 Å) | | Cite: | Crystal Structure of the Pleckstrin Homology Domain of Pepp1
To be Published
|
|
1URH
 | | The "Rhodanese" fold and catalytic mechanism of 3-mercaptopyruvate sulfotransferases: Crystal structure of SseA from Escherichia coli | | Descriptor: | 3-MERCAPTOPYRUVATE SULFURTRANSFERASE, SULFITE ION | | Authors: | Spallarossa, A, Forlani, F, Carpen, A, Armirotti, A, Pagani, S, Bolognesi, M, Bordo, D. | | Deposit date: | 2003-10-30 | | Release date: | 2003-12-18 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | The "Rhodanese" Fold and Catalytic Mechanism of 3-Mercaptopyruvate Sulfurtransferases: Crystal Structure of Ssea from Escherichia Coli
J.Mol.Biol., 335, 2004
|
|
3DLQ
 | | Crystal structure of the IL-22/IL-22R1 complex | | Descriptor: | Interleukin-22, Interleukin-22 receptor subunit alpha-1 | | Authors: | Bleicher, L, de Moura, P.R, Watanabe, L, Colau, D, Dumoutier, L, Renauld, J.-C, Polikarpov, I. | | Deposit date: | 2008-06-28 | | Release date: | 2008-08-19 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Crystal structure of the IL-22/IL-22R1 complex and its implications for the IL-22 signaling mechanism
Febs Lett., 582, 2008
|
|
5D9C
 | | Luciferin-regenerating enzyme solved by SIRAS using XFEL (refined against Hg derivative data) | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, Luciferin regenerating enzyme, MAGNESIUM ION, ... | | Authors: | Yamashita, K, Pan, D, Okuda, T, Murai, T, Kodan, A, Yamaguchi, T, Gomi, K, Kajiyama, N, Kato, H, Ago, H, Yamamoto, M, Nakatsu, T. | | Deposit date: | 2015-08-18 | | Release date: | 2015-09-23 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | An isomorphous replacement method for efficient de novo phasing for serial femtosecond crystallography.
Sci Rep, 5, 2015
|
|
5DAZ
 | |
1UVR
 | | Structure of human PDK1 kinase domain in complex with BIM-8 | | Descriptor: | 3-PHOSPHOINOSITIDE DEPENDENT PROTEIN KINASE-1, 3-[1-(3-AMINOPROPYL)-1H-INDOL-3-YL]-4-(1-METHYL-1H-INDOL-3-YL)-1H-PYRROLE-2,5-DIONE, GLYCEROL, ... | | Authors: | Komander, D, Garrido-Franco, M, Kular, G.S, Schuttelkopf, A.W, Deak, M, Prakash, K.R, Bain, J, Elliot, M, Kozikowski, A.P, Alessi, D.R, Van Aalten, D.M.F. | | Deposit date: | 2004-01-22 | | Release date: | 2004-03-04 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.81 Å) | | Cite: | Interactions of Ly333531 and Other Bisindolyl Maleimide Inhibitors with Pdk1
Structure, 12, 2004
|
|
5DH8
 | | Two divalent metal ions and conformational changes play roles in the hammerhead ribozyme cleavage reaction- G12A mutant in Zn2+ | | Descriptor: | 5'-R(*GP*GP*GP*CP*GP*U)-D(P*C)-R(P*UP*GP*GP*GP*CP*AP*GP*UP*AP*CP*CP*CP*A)-3', RNA (48-MER), ZINC ION | | Authors: | Mir, A, Chen, J, Neau, D, Golden, B.L. | | Deposit date: | 2015-08-29 | | Release date: | 2015-10-07 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (3.297 Å) | | Cite: | Two Divalent Metal Ions and Conformational Changes Play Roles in the Hammerhead Ribozyme Cleavage Reaction.
Biochemistry, 54, 2015
|
|
5DHH
 | | The crystal structure of nociceptin/orphanin FQ peptide receptor (NOP) in complex with SB-612111 (PSI Community Target) | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, (5S,7S)-7-{[4-(2,6-dichlorophenyl)piperidin-1-yl]methyl}-1-methyl-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-ol, OLEIC ACID, ... | | Authors: | Miller, R.L, Thompson, A.A, Trapella, C, Guerrini, R, Malfacini, D, Patel, N, Han, G.W, Cherezov, V, Calo, G, Katritch, V, Stevens, R.C, GPCR Network (GPCR) | | Deposit date: | 2015-08-31 | | Release date: | 2015-10-21 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (3.004 Å) | | Cite: | The Importance of Ligand-Receptor Conformational Pairs in Stabilization: Spotlight on the N/OFQ G Protein-Coupled Receptor.
Structure, 23, 2015
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
1UT0
 | | CRYSTAL STRUCTURE OF CYTOGLOBIN: THE FOURTH GLOBIN TYPE DISCOVERED IN MAN DISPLAYS HEME HEXA-COORDINATION | | Descriptor: | CYTOGLOBIN, HEXACYANOFERRATE(3-), PROTOPORPHYRIN IX CONTAINING FE | | Authors: | De Sanctis, D, Dewilde, S, Pesce, A, Moens, L, Ascenzi, P, Hankeln, T, Burmester, T, Bolognesi, M. | | Deposit date: | 2003-12-02 | | Release date: | 2004-06-01 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Crystal Structure of Cytoglobin: The Fourth Globin Type Discovered in Man Displays Heme Hexa-Coordination
J.Mol.Biol., 336, 2004
|
|
5E08
 | | Specific Recognition of a Single-stranded RNA Sequence by an Engineered Synthetic Antibody Fragment | | Descriptor: | Fab Heavy Chain, Fab Light Chain, RNA | | Authors: | Huang, H, Qin, D, Li, N, Shao, Y, Staley, J.P, Kossiakoff, A.A, Koide, S, Piccirilli, J.A. | | Deposit date: | 2015-09-28 | | Release date: | 2016-09-21 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.38 Å) | | Cite: | Specific Recognition of a Single-Stranded RNA Sequence by a Synthetic Antibody Fragment.
J.Mol.Biol., 428, 2016
|
|
5E3B
 | | Structure of macrodomain protein from Streptomyces coelicolor | | Descriptor: | 1,2-ETHANEDIOL, Macrodomain protein, SODIUM ION | | Authors: | Lalic, J, Posavec Marjanovic, M, Perina, D, Sabljic, I, Zaja, R, Plese, B, Imesek, M, Bucca, G, Ahel, M, Cetkovic, H, Luic, M, Mikoc, A, Ahel, I. | | Deposit date: | 2015-10-02 | | Release date: | 2016-09-28 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Disruption of Macrodomain Protein SCO6735 Increases Antibiotic Production in Streptomyces coelicolor.
J.Biol.Chem., 291, 2016
|
|
