3CI5
| |
3HIE
| |
8CDK
| |
8CDJ
| CAND1 b-hairpin++-SCF-SKP2 CAND1 rolling SCF engaged | Descriptor: | Cullin-1, Cullin-associated NEDD8-dissociated protein 1, E3 ubiquitin-protein ligase RBX1, ... | Authors: | Baek, K, Schulman, B.A. | Deposit date: | 2023-01-31 | Release date: | 2023-04-19 | Last modified: | 2023-05-10 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | Systemwide disassembly and assembly of SCF ubiquitin ligase complexes. Cell, 186, 2023
|
|
7ZBZ
| |
6TTU
| Ubiquitin Ligation to substrate by a cullin-RING E3 ligase at 3.7A resolution: NEDD8-CUL1-RBX1 N98R-SKP1-monomeric b-TRCP1dD-IkBa-UB~UBE2D2 | Descriptor: | CYS-LYS-LYS-ALA-ARG-HIS-ASP-SEP-GLY, Cullin-1, E3 ubiquitin-protein ligase RBX1, ... | Authors: | Baek, K, Prabu, J.R, Schulman, B.A. | Deposit date: | 2019-12-30 | Release date: | 2020-02-12 | Last modified: | 2020-03-04 | Method: | ELECTRON MICROSCOPY (3.7 Å) | Cite: | NEDD8 nucleates a multivalent cullin-RING-UBE2D ubiquitin ligation assembly. Nature, 578, 2020
|
|
7Z8T
| CAND1-SCF-SKP2 CAND1 engaged SCF rocked | Descriptor: | Cullin-1, Cullin-associated NEDD8-dissociated protein 1, E3 ubiquitin-protein ligase RBX1, ... | Authors: | Baek, K, Schulman, B.A. | Deposit date: | 2022-03-18 | Release date: | 2023-04-19 | Last modified: | 2023-05-10 | Method: | ELECTRON MICROSCOPY (3 Å) | Cite: | Systemwide disassembly and assembly of SCF ubiquitin ligase complexes. Cell, 186, 2023
|
|
7ZBW
| CAND1-SCF-SKP2 CAND1 rolling-2 SCF engaged | Descriptor: | Cullin-1, Cullin-associated NEDD8-dissociated protein 1, E3 ubiquitin-protein ligase RBX1, ... | Authors: | Baek, K, Schulman, B.A. | Deposit date: | 2022-03-24 | Release date: | 2023-04-19 | Last modified: | 2023-05-10 | Method: | ELECTRON MICROSCOPY (3.5 Å) | Cite: | Systemwide disassembly and assembly of SCF ubiquitin ligase complexes. Cell, 186, 2023
|
|
7Z8R
| CAND1-CUL1-RBX1 | Descriptor: | Cullin-1, Cullin-associated NEDD8-dissociated protein 1, E3 ubiquitin-protein ligase RBX1, ... | Authors: | Baek, K, Schulman, B.A. | Deposit date: | 2022-03-18 | Release date: | 2023-04-19 | Last modified: | 2023-05-10 | Method: | ELECTRON MICROSCOPY (2.7 Å) | Cite: | Systemwide disassembly and assembly of SCF ubiquitin ligase complexes. Cell, 186, 2023
|
|
7Z8V
| CAND1-SCF-SKP2 (SKP1deldel) CAND1 engaged SCF rocked | Descriptor: | Cullin-1, Cullin-associated NEDD8-dissociated protein 1, E3 ubiquitin-protein ligase RBX1, ... | Authors: | Baek, K, Schulman, B.A. | Deposit date: | 2022-03-18 | Release date: | 2023-04-19 | Last modified: | 2023-05-10 | Method: | ELECTRON MICROSCOPY (2.7 Å) | Cite: | Systemwide disassembly and assembly of SCF ubiquitin ligase complexes. Cell, 186, 2023
|
|
2I53
| Crystal structure of Cyclin K | Descriptor: | ACETATE ION, Cyclin K | Authors: | Baek, K, Brown, R.S, Birrane, G, Ladias, J.A.A. | Deposit date: | 2006-08-23 | Release date: | 2007-01-02 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Crystal Structure of Human Cyclin K, a Positive Regulator of Cyclin-dependent Kinase 9. J.Mol.Biol., 366, 2007
|
|
3CHW
| |
3CIP
| Complex of Dictyostelium Discoideum Actin with Gelsolin | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, CALCIUM ION, GLYCEROL, ... | Authors: | Baek, K, Dominguez, R. | Deposit date: | 2008-03-11 | Release date: | 2008-08-19 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Modulation of actin structure and function by phosphorylation of Tyr-53 and profilin binding. Proc.Natl.Acad.Sci.Usa, 105, 2008
|
|
3T8S
| Apo and InsP3-bound Crystal Structures of the Ligand-Binding Domain of an InsP3 Receptor | Descriptor: | D-MYO-INOSITOL-1,4,5-TRIPHOSPHATE, Inositol 1,4,5-trisphosphate receptor type 1 | Authors: | Lin, C, Baek, K, Lu, Z. | Deposit date: | 2011-08-01 | Release date: | 2011-09-07 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (3.77 Å) | Cite: | Apo and InsP(3)-bound crystal structures of the ligand-binding domain of an InsP(3) receptor. Nat.Struct.Mol.Biol., 18, 2011
|
|
7OXA
| Target-bound SpCas9 complex with AAVS1 chimeric RNA-DNA guide | Descriptor: | AAVS1 non-target DNA strand, AAVS1 target DNA strand, CRISPR-associated endonuclease Cas9/Csn1, ... | Authors: | Donohoue, P, Pacesa, M, Lau, E, Vidal, B, Irby, M.J, Nyer, D.B, Rotstein, T, Banh, L, Toh, M.T, Gibson, J, Kohrs, B, Baek, K, Owen, A.L.G, Slorach, E.M, van Overbeek, M, Fuller, C.K, May, A.P, Jinek, M, Cameron, P. | Deposit date: | 2021-06-22 | Release date: | 2021-09-15 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.15 Å) | Cite: | Conformational control of Cas9 by CRISPR hybrid RNA-DNA guides mitigates off-target activity in T cells. Mol.Cell, 81, 2021
|
|
7OX7
| Target-bound SpCas9 complex with TRAC chimeric RNA-DNA guide | Descriptor: | CRISPR-associated endonuclease Cas9/Csn1, MAGNESIUM ION, POTASSIUM ION, ... | Authors: | Donohoue, P, Pacesa, M, Lau, E, Vidal, B, Irby, M.J, Nyer, D.B, Rotstein, T, Banh, L, Toh, M.T, Gibson, J, Kohrs, B, Baek, K, Owen, A.L.G, Slorach, E.M, van Overbeek, M, Fuller, C.K, May, A.P, Jinek, M, Cameron, P. | Deposit date: | 2021-06-22 | Release date: | 2021-09-15 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Conformational control of Cas9 by CRISPR hybrid RNA-DNA guides mitigates off-target activity in T cells. Mol.Cell, 81, 2021
|
|
7OX8
| Target-bound SpCas9 complex with TRAC full RNA guide | Descriptor: | CRISPR-associated endonuclease Cas9/Csn1, MAGNESIUM ION, POTASSIUM ION, ... | Authors: | Donohoue, P, Pacesa, M, Lau, E, Vidal, B, Irby, M.J, Nyer, D.B, Rotstein, T, Banh, L, Toh, M.T, Gibson, J, Kohrs, B, Baek, K, Owen, A.L.G, Slorach, E.M, van Overbeek, M, Fuller, C.K, May, A.P, Jinek, M, Cameron, P. | Deposit date: | 2021-06-22 | Release date: | 2021-09-15 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.75 Å) | Cite: | Conformational control of Cas9 by CRISPR hybrid RNA-DNA guides mitigates off-target activity in T cells. Mol.Cell, 81, 2021
|
|
1A77
| FLAP ENDONUCLEASE-1 FROM METHANOCOCCUS JANNASCHII | Descriptor: | FLAP ENDONUCLEASE-1 PROTEIN, MAGNESIUM ION | Authors: | Hwang, K.Y, Baek, K, Kim, H, Cho, Y. | Deposit date: | 1998-03-20 | Release date: | 1999-08-03 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | The crystal structure of flap endonuclease-1 from Methanococcus jannaschii. Nat.Struct.Biol., 5, 1998
|
|
1A76
| FLAP ENDONUCLEASE-1 FROM METHANOCOCCUS JANNASCHII | Descriptor: | FLAP ENDONUCLEASE-1 PROTEIN, MANGANESE (II) ION | Authors: | Hwang, K.Y, Baek, K, Kim, H, Cho, Y. | Deposit date: | 1998-03-20 | Release date: | 1999-08-03 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | The crystal structure of flap endonuclease-1 from Methanococcus jannaschii. Nat.Struct.Biol., 5, 1998
|
|
3E5H
| Crystal Structure of Rab28 GTPase in the Active (GppNHp-bound) Form | Descriptor: | GLYCEROL, MAGNESIUM ION, PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER, ... | Authors: | Lee, S.H, Baek, K, Li, Y, Dominguez, R. | Deposit date: | 2008-08-13 | Release date: | 2008-08-26 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (1.499 Å) | Cite: | Large nucleotide-dependent conformational change in Rab28. Febs Lett., 582, 2008
|
|
4P0P
| Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0R
| human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6.501 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0Q
| Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.851 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0S
| human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
1LJ5
| |