1KWP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kwp by Molmil](/molmil-images/mine/1kwp) | Crystal Structure of MAPKAP2 | Descriptor: | MAP Kinase Activated Protein Kinase 2, MERCURY (II) ION | Authors: | Meng, W, Swenson, L.L, Fitzgibbon, M.J, Hayakawa, K, ter Haar, E, Behrens, A.E, Fulghum, J.R, Lippke, J.A. | Deposit date: | 2002-01-30 | Release date: | 2002-09-18 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Structure of Mitogen-activated Protein Kinase-activated Protein (MAPKAP) Kinase 2 Suggests a Bifunctional Switch That
Couples Kinase Activation with Nuclear Export J.Biol.Chem., 277, 2002
|
|
1KMF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kmf by Molmil](/molmil-images/mine/1kmf) | NMR STRUCTURE OF HUMAN INSULIN MUTANT ILE-A2-ALLO-ILE, HIS-B10-ASP, PRO-B28-LYS, LYS-B29-PRO, 15 STRUCTURES | Descriptor: | Insulin | Authors: | Xu, B, Hua, Q.X, Nakagawa, S.H, Jia, W, Chu, Y.C, Katsoyannis, P.G, Weiss, M.A. | Deposit date: | 2001-12-14 | Release date: | 2002-01-09 | Last modified: | 2021-10-27 | Method: | SOLUTION NMR | Cite: | Chiral mutagenesis of insulin's hidden receptor-binding surface: structure of an allo-isoleucine(A2) analogue. J.Mol.Biol., 316, 2002
|
|
6OO3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6oo3 by Molmil](/molmil-images/mine/6oo3) | Cryo-EM structure of the C4-symmetric TRPV2/RTx complex in amphipol resolved to 2.9 A | Descriptor: | TRPV2, resiniferatoxin | Authors: | Zubcevic, L, Hsu, A.L, Borgnia, M.J, Lee, S.-Y. | Deposit date: | 2019-04-22 | Release date: | 2019-05-29 | Last modified: | 2024-03-20 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | Symmetry transitions during gating of the TRPV2 ion channel in lipid membranes. Elife, 8, 2019
|
|
4N2L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4n2l by Molmil](/molmil-images/mine/4n2l) | Crystal structure of Protein Arginine Deiminase 2 (Q350A, 10 mM Ca2+) | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, ACETATE ION, CALCIUM ION, ... | Authors: | Slade, D.J, Zhang, X, Fang, P, Dreyton, C.J, Zhang, Y, Gross, M.L, Guo, M, Coonrod, S.A, Thompson, P.R. | Deposit date: | 2013-10-05 | Release date: | 2015-02-04 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Protein arginine deiminase 2 binds calcium in an ordered fashion: implications for inhibitor design. Acs Chem.Biol., 10, 2015
|
|
1KSS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kss by Molmil](/molmil-images/mine/1kss) | Crystal Structure of His505Ala Mutant Flavocytochrome c3 from Shewanella frigidimarina | Descriptor: | FLAVIN-ADENINE DINUCLEOTIDE, FUMARIC ACID, PROTOPORPHYRIN IX CONTAINING FE, ... | Authors: | Pankhurst, K.L, Mowat, C.G, Miles, C.S, Leys, D, Walkinshaw, M.D, Reid, G.A, Chapman, S.K. | Deposit date: | 2002-01-14 | Release date: | 2002-08-14 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Role of His505 in the soluble fumarate reductase from Shewanella frigidimarina. Biochemistry, 41, 2002
|
|
6XUM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6xum by Molmil](/molmil-images/mine/6xum) | Human Aldose Reductase Mutant L300/301A in Complex with a Ligand with an IDD Structure ({5-fluoro-2-[(3-nitrobenzyl)carbamoyl]phenoxy}acetic acid) | Descriptor: | Aldo-keto reductase family 1 member B1, CITRIC ACID, NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, ... | Authors: | Hubert, L.-S, Ley, M, Heine, A, Klebe, G. | Deposit date: | 2020-01-20 | Release date: | 2021-02-03 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (0.97 Å) | Cite: | Human Aldose Reductase Mutant L300/301A in Complex with a Ligand with an IDD Structure ({5-fluoro-2-[(3-nitrobenzyl)carbamoyl]phenoxy}acetic acid) To Be Published
|
|
5XIQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xiq by Molmil](/molmil-images/mine/5xiq) | Crystal Structure of Toxoplasma gondii Prolyl-tRNA Synthetase (TgPRS) in complex with Halofuginone | Descriptor: | 7-bromo-6-chloro-3-{3-[(2R,3S)-3-hydroxypiperidin-2-yl]-2-oxopropyl}quinazolin-4(3H)-one, MAGNESIUM ION, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER, ... | Authors: | Jain, V, Manickam, Y, Sharma, A. | Deposit date: | 2017-04-26 | Release date: | 2018-03-07 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.19 Å) | Cite: | Targeting Prolyl-tRNA Synthetase to Accelerate Drug Discovery against Malaria, Leishmaniasis, Toxoplasmosis, Cryptosporidiosis, and Coccidiosis Structure, 25, 2017
|
|
6OO4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6oo4 by Molmil](/molmil-images/mine/6oo4) | Cryo-EM structure of the C2-symmetric TRPV2/RTx complex in amphipol resolved to 3.3 A | Descriptor: | TRPV2, resiniferatoxin | Authors: | Zubcevic, L, Hsu, A.L, Borgnia, M.J, Lee, S.-Y. | Deposit date: | 2019-04-22 | Release date: | 2019-05-29 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.3 Å) | Cite: | Symmetry transitions during gating of the TRPV2 ion channel in lipid membranes. Elife, 8, 2019
|
|
8CKF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8ckf by Molmil](/molmil-images/mine/8ckf) | Crystal Structure of the first bromodomain of human BRD4 L94C variant in complex with racemic 3,5-dimethylisoxazol ligand | Descriptor: | 3-(3,5-dimethyl-1,2-oxazol-4-yl)-5-[(~{R})-oxidanyl(pyridin-3-yl)methyl]phenol, 3-(3,5-dimethyl-1,2-oxazol-4-yl)-5-[(~{S})-oxidanyl(pyridin-3-yl)methyl]phenol, Bromodomain-containing protein 4 | Authors: | Thomas, A.M, McDonough, M.A, Schiedel, M, Conway, S.J. | Deposit date: | 2023-02-15 | Release date: | 2023-08-02 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (1.88 Å) | Cite: | Mutate and Conjugate: A Method to Enable Rapid In-Cell Target Validation. Acs Chem.Biol., 18, 2023
|
|
1KLC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1klc by Molmil](/molmil-images/mine/1klc) | SOLUTION STRUCTURE OF TGF-B1, NMR, MINIMIZED AVERAGE STRUCTURE | Descriptor: | TRANSFORMING GROWTH FACTOR-BETA 1 | Authors: | Hinck, A.P, Archer, S.J, Qian, S.W, Roberts, A.B, Sporn, M.B, Weatherbee, J.A, Tsang, M.L.-S, Lucas, R, Zhang, B.-L, Wenker, J, Torchia, D.A. | Deposit date: | 1996-01-16 | Release date: | 1996-08-17 | Last modified: | 2017-11-29 | Method: | SOLUTION NMR | Cite: | Transforming growth factor beta 1: three-dimensional structure in solution and comparison with the X-ray structure of transforming growth factor beta 2. Biochemistry, 35, 1996
|
|
1KLD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kld by Molmil](/molmil-images/mine/1kld) | SOLUTION STRUCTURE OF TGF-B1, NMR, MODELS 18-33 OF 33 STRUCTURES | Descriptor: | TRANSFORMING GROWTH FACTOR-BETA 1 | Authors: | Hinck, A.P, Archer, S.J, Qian, S.W, Roberts, A.B, Sporn, M.B, Weatherbee, J.A, Tsang, M.L.-S, Lucas, R, Zhang, B.-L, Wenker, J, Torchia, D.A. | Deposit date: | 1996-01-16 | Release date: | 1996-08-17 | Last modified: | 2017-11-29 | Method: | SOLUTION NMR | Cite: | Transforming growth factor beta 1: three-dimensional structure in solution and comparison with the X-ray structure of transforming growth factor beta 2. Biochemistry, 35, 1996
|
|
1TN1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1tn1 by Molmil](/molmil-images/mine/1tn1) | CRYSTALLOGRAPHIC AND BIOCHEMICAL INVESTIGATION OF THE LEAD(II)-CATALYZED HYDROLYSIS OF YEAST PHENYLALANINE TRNA | Descriptor: | LEAD (II) ION, MAGNESIUM ION, SPERMINE, ... | Authors: | Dewan, J.C, Brown, R.S, Hingerty, B.E, Klug, A. | Deposit date: | 1986-12-04 | Release date: | 1987-01-15 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Crystallographic and biochemical investigation of the lead(II)-catalyzed hydrolysis of yeast phenylalanine tRNA. Biochemistry, 24, 1985
|
|
1KO7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ko7 by Molmil](/molmil-images/mine/1ko7) | X-ray structure of the HPr kinase/phosphatase from Staphylococcus xylosus at 1.95 A resolution | Descriptor: | Hpr kinase/phosphatase, PHOSPHATE ION | Authors: | Marquez, J.A, Hasenbein, S, Koch, B, Fieulaine, S, Nessler, S, Hengstenberg, W, Scheffzek, K. | Deposit date: | 2001-12-20 | Release date: | 2002-04-03 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.95 Å) | Cite: | Structure of the full-length HPr kinase/phosphatase from Staphylococcus xylosus at 1.95 A resolution: Mimicking the product/substrate of the phospho transfer reactions. Proc.Natl.Acad.Sci.USA, 99, 2002
|
|
4N1U
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4n1u by Molmil](/molmil-images/mine/4n1u) | Structure of human MTH1 in complex with TH588 | Descriptor: | 7,8-dihydro-8-oxoguanine triphosphatase, N~4~-cyclopropyl-6-(2,3-dichlorophenyl)pyrimidine-2,4-diamine, SULFATE ION | Authors: | Berntsson, R.P.-A, Jemth, A, Gustafsson, R, Svensson, L.M, Helleday, T, Stenmark, P. | Deposit date: | 2013-10-04 | Release date: | 2014-04-16 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | MTH1 inhibition eradicates cancer by preventing sanitation of the dNTP pool. Nature, 508, 2014
|
|
2P7E
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2p7e by Molmil](/molmil-images/mine/2p7e) | Vanadate at the Active Site of a Small Ribozyme Suggests a Role for Water in Transition-State Stabilization | Descriptor: | 3' substrate strand, octameric fragment, 5' substrate strand, ... | Authors: | Torelli, A.T, Krucinska, J, Wedekind, J.E. | Deposit date: | 2007-03-20 | Release date: | 2007-05-22 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.05 Å) | Cite: | A comparison of vanadate to a 2'-5' linkage at the active site of a small ribozyme suggests a role for water in transition-state stabilization Rna, 13, 2007
|
|
1KVF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kvf by Molmil](/molmil-images/mine/1kvf) | |
2P7D
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2p7d by Molmil](/molmil-images/mine/2p7d) | A Minimal, 'Hinged' Hairpin Ribozyme Construct Solved with Mimics of the Product Strands at 2.25 Angstroms Resolution | Descriptor: | 3' substrate strand, octameric fragment, 5' substrate strand, ... | Authors: | Torelli, A.T, Krucinska, J, Wedekind, J.E. | Deposit date: | 2007-03-20 | Release date: | 2007-05-22 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.25 Å) | Cite: | A comparison of vanadate to a 2'-5' linkage at the active site of a small ribozyme suggests a role for water in transition-state stabilization Rna, 13, 2007
|
|
8C3D
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8c3d by Molmil](/molmil-images/mine/8c3d) | Sulfonated Calpeptin is a promising drug candidate against SARS-CoV-2 infections | Descriptor: | 3-PYRIDIN-4-YL-2,4-DIHYDRO-INDENO[1,2-.C.]PYRAZOLE, CALCIUM ION, Cathepsin K | Authors: | Loboda, J, Karnicar, K, Lindic, N, Usenik, A, Lieske, J, Meents, A, Guenther, S, Reinke, P.Y.A, Falke, S, Ewert, W, Turk, D. | Deposit date: | 2022-12-23 | Release date: | 2023-09-27 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Calpeptin is a potent cathepsin inhibitor and drug candidate for SARS-CoV-2 infections. Commun Biol, 6, 2023
|
|
1KX3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx3 by Molmil](/molmil-images/mine/1kx3) | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KSR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ksr by Molmil](/molmil-images/mine/1ksr) | THE REPEATING SEGMENTS OF THE F-ACTIN CROSS-LINKING GELATION FACTOR (ABP-120) HAVE AN IMMUNOGLOBULIN FOLD, NMR, 20 STRUCTURES | Descriptor: | GELATION FACTOR | Authors: | Fucini, P, Renner, C, Herberhold, C, Noegel, A.A, Holak, T.A. | Deposit date: | 1997-02-07 | Release date: | 1997-08-20 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | The repeating segments of the F-actin cross-linking gelation factor (ABP-120) have an immunoglobulin-like fold. Nat.Struct.Biol., 4, 1997
|
|
2PO5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2po5 by Molmil](/molmil-images/mine/2po5) | Crystal structure of human ferrochelatase mutant with His 263 replaced by Cys | Descriptor: | CHOLIC ACID, FE2/S2 (INORGANIC) CLUSTER, Ferrochelatase, ... | Authors: | Dailey, H.A, Wu, C.-K, Horanyi, P, Medlock, A.E, Najahi-Missaoui, A.E.W, Burden, A, Dailey, T.A, Rose, J.P. | Deposit date: | 2007-04-25 | Release date: | 2007-10-02 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Altered orientation of active site residues in variants of human ferrochelatase. Evidence for a hydrogen bond network involved in catalysis Biochemistry, 46, 2007
|
|
1KDR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kdr by Molmil](/molmil-images/mine/1kdr) | CYTIDINE MONOPHOSPHATE KINASE FROM E.COLI IN COMPLEX WITH ARA-CYTIDINE MONOPHOSPHATE | Descriptor: | CYTIDYLATE KINASE, CYTOSINE ARABINOSE-5'-PHOSPHATE, SULFATE ION | Authors: | Bertrand, T, Briozzo, P, Assairi, L, Ofiteru, A, Bucurenci, N, Munier-Lehmann, H, Golinelli-Pimpaneau, B, Barzu, O, Gilles, A.M. | Deposit date: | 2001-11-13 | Release date: | 2002-01-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.25 Å) | Cite: | Sugar specificity of bacterial CMP kinases as revealed by crystal structures and mutagenesis of Escherichia coli enzyme. J.Mol.Biol., 315, 2002
|
|
5IKE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ike by Molmil](/molmil-images/mine/5ike) | |
6XC3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6xc3 by Molmil](/molmil-images/mine/6xc3) | Crystal structure of SARS-CoV-2 receptor binding domain in complex with antibodies CC12.1 and CR3022 | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, CC12.1 heavy chain, CC12.1 light chain, ... | Authors: | Yuan, M, Liu, H, Wu, N.C, Zhu, X, Wilson, I.A. | Deposit date: | 2020-06-08 | Release date: | 2020-07-08 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (2.698 Å) | Cite: | Structural basis of a shared antibody response to SARS-CoV-2. Science, 369, 2020
|
|
7NBM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7nbm by Molmil](/molmil-images/mine/7nbm) | Co-crystal structure of Human Nicotinamide N-methyltransferase (NNMT) with the bisubstrate-like inhibitor (33) | Descriptor: | (E)-3-((5,6-dihydro-2H,4H-thiazolo[5,4,3-ij]quinolin-2-ylidene)amino)-2-hydroxy-1-(4-(isoquinolin-5-yl)piperazin-1-yl)-2-methylpropan-1-one, Nicotinamide N-methyltransferase | Authors: | Schreuder, H.A, Liesum, A. | Deposit date: | 2021-01-27 | Release date: | 2021-03-17 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.691 Å) | Cite: | Novel Inhibitors of Nicotinamide- N -Methyltransferase for the Treatment of Metabolic Disorders. Molecules, 26, 2021
|
|