1AOI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1aoi by Molmil](/molmil-images/mine/1aoi) | COMPLEX BETWEEN NUCLEOSOME CORE PARTICLE (H3,H4,H2A,H2B) AND 146 BP LONG DNA FRAGMENT | Descriptor: | HISTONE H2A, HISTONE H2B, HISTONE H3, ... | Authors: | Luger, K, Maeder, A.W, Richmond, R.K, Sargent, D.F, Richmond, T.J. | Deposit date: | 1997-07-03 | Release date: | 1998-09-30 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature, 389, 1997
|
|
2NQB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2nqb by Molmil](/molmil-images/mine/2nqb) | Drosophila Nucleosome Structure | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Luger, K, Chakravarthy, S. | Deposit date: | 2006-10-30 | Release date: | 2007-09-11 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Comparative analysis of nucleosome structures from different species. To be Published
|
|
3C1C
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3c1c by Molmil](/molmil-images/mine/3c1c) | The effect of H3 K79 dimethylation and H4 K20 trimethylation on nucleosome and chromatin structure | Descriptor: | Histone 2, H2bf, Histone H2A type 1, ... | Authors: | Lu, X, Simon, M, Chodaparambil, J, Hansen, J, Shokat, K, Luger, K. | Deposit date: | 2008-01-22 | Release date: | 2008-10-07 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (3.15 Å) | Cite: | The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure. Nat.Struct.Mol.Biol., 15, 2008
|
|
1M1A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1m1a by Molmil](/molmil-images/mine/1m1a) | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2002-06-18 | Release date: | 2003-02-18 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.65 Å) | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands J.MOL.BIOL., 326, 2003
|
|
5T5K
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5t5k by Molmil](/molmil-images/mine/5t5k) | Structure of histone-based chromatin in Archaea | Descriptor: | CACODYLATE ION, DNA (90-MER), DNA-binding protein HMf-2 | Authors: | Bhattacharyya, S, Mattiroli, F, Dyer, P.N, Sandman, K, Reeve, J.N, Luger, K. | Deposit date: | 2016-08-31 | Release date: | 2017-08-23 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (4 Å) | Cite: | Structure of histone-based chromatin in Archaea. Science, 357, 2017
|
|
6C0W
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6c0w by Molmil](/molmil-images/mine/6c0w) | Cryo-EM structure of human kinetochore protein CENP-N with the centromeric nucleosome containing CENP-A | Descriptor: | 147 mer DNA, Centromere protein N, Histone H2A, ... | Authors: | Zhou, K, Pentakota, S, Vetter, I.R, Morgan, G.P, Petrovic, A, Musacchio, A, Luger, K. | Deposit date: | 2018-01-02 | Release date: | 2018-01-17 | Last modified: | 2024-03-13 | Method: | ELECTRON MICROSCOPY (4 Å) | Cite: | Decoding the centromeric nucleosome through CENP-N. Elife, 6, 2017
|
|
7U46
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7u46 by Molmil](/molmil-images/mine/7u46) | |
7U47
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7u47 by Molmil](/molmil-images/mine/7u47) | |
7U4D
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7u4d by Molmil](/molmil-images/mine/7u4d) | |
8FW7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8fw7 by Molmil](/molmil-images/mine/8fw7) | Histone from Bdellovibrio bacteriovorus bound to dsDNA | Descriptor: | CBFD_NFYB_HMF domain-containing protein, DNA (5'-D(P*AP*T)-3'), DNA (5'-D(P*CP*AP*T)-3') | Authors: | Laursen, S.P, Luger, K. | Deposit date: | 2023-01-20 | Release date: | 2023-08-30 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Histones with an unconventional DNA-binding mode in vitro are major chromatin constituents in the bacterium Bdellovibrio bacteriovorus. Nat Microbiol, 8, 2023
|
|
8FVX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8fvx by Molmil](/molmil-images/mine/8fvx) | Histone from Bdellovibrio bacteriovorus | Descriptor: | CBFD_NFYB_HMF domain-containing protein | Authors: | Laursen, S.P, Luger, K. | Deposit date: | 2023-01-19 | Release date: | 2023-08-30 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Histones with an unconventional DNA-binding mode in vitro are major chromatin constituents in the bacterium Bdellovibrio bacteriovorus. Nat Microbiol, 8, 2023
|
|
7N8N
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7n8n by Molmil](/molmil-images/mine/7n8n) | Melbournevirus nucleosome like particle | Descriptor: | DNA (147-MER), Histone H2B-H2A doublet, Histone H4-H3 doublet | Authors: | Liu, Y, Toner, C.M, Zhou, K, Bowerman, S, Luger, K. | Deposit date: | 2021-06-15 | Release date: | 2021-08-04 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (3.89 Å) | Cite: | Virus-encoded histone doublets are essential and form nucleosome-like structures. Cell, 184, 2021
|
|
3NFQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3nfq by Molmil](/molmil-images/mine/3nfq) | |
4Z66
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4z66 by Molmil](/molmil-images/mine/4z66) | Nucleosome disassembly by RSC and SWI/SNF is enhanced by H3 acetylation near the nucleosome dyad axis | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B 1.1, ... | Authors: | Dechassa, M.L, Luger, K, Chatterjee, N, North, J.A, Manohar, M, Prasad, R, Ottessen, J.J, Poirier, M.G, Bartholomew, B. | Deposit date: | 2015-04-03 | Release date: | 2015-10-14 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Histone Acetylation near the Nucleosome Dyad Axis Enhances Nucleosome Disassembly by RSC and SWI/SNF. Mol.Cell.Biol., 35, 2015
|
|
6UPL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6upl by Molmil](/molmil-images/mine/6upl) | Structure of FACT_subnucleosome complex 2 | Descriptor: | DNA (79-mer), FACT complex subunit SPT16, FACT complex subunit SSRP1, ... | Authors: | Zhou, K, Tan, Y.Z, Wei, H, Liu, Y, Carragher, B, Potter, C, Luger, K. | Deposit date: | 2019-10-17 | Release date: | 2019-12-11 | Last modified: | 2024-03-20 | Method: | ELECTRON MICROSCOPY (7.4 Å) | Cite: | FACT caught in the act of manipulating the nucleosome. Nature, 577, 2020
|
|
6UPK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6upk by Molmil](/molmil-images/mine/6upk) | Structure of FACT_subnucleosome complex 1 | Descriptor: | DNA (79-mer), FACT complex subunit SPT16, FACT complex subunit SSRP1, ... | Authors: | Zhou, K, Tan, Y.Z, Wei, H, Liu, Y, Carragher, B, Potter, C, Luger, K. | Deposit date: | 2019-10-17 | Release date: | 2019-12-11 | Last modified: | 2024-03-20 | Method: | ELECTRON MICROSCOPY (4.9 Å) | Cite: | FACT caught in the act of manipulating the nucleosome. Nature, 577, 2020
|
|
4XZQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4xzq by Molmil](/molmil-images/mine/4xzq) | Nucleosome disassembly by RSC and SWI/SNF is enhanced by H3 acetylation near the nucleosome dyad axis | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B 1.1, ... | Authors: | Dechassa, M.L, Luger, K, Chatterjee, N, North, J.A, Manohar, M, Prasad, R, Ottessen, J.J, Poirier, M.G, Bartholomew, B. | Deposit date: | 2015-02-04 | Release date: | 2015-10-14 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Histone Acetylation near the Nucleosome Dyad Axis Enhances Nucleosome Disassembly by RSC and SWI/SNF. Mol.Cell.Biol., 35, 2015
|
|
4YS3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4ys3 by Molmil](/molmil-images/mine/4ys3) | Nucleosome disassembly by RSC and SWI/SNF is enhanced by H3 acetylation near the nucleosome dyad axis | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B 1.1, ... | Authors: | Dechassa, M.L, Luger, K, Chatterjee, N, North, J.A, Manohar, M, Prasad, R, Ottessen, J.J, Poirier, M.G, Bartholomew, B. | Deposit date: | 2015-03-16 | Release date: | 2015-10-14 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Histone Acetylation near the Nucleosome Dyad Axis Enhances Nucleosome Disassembly by RSC and SWI/SNF. Mol.Cell.Biol., 35, 2015
|
|
6USJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6usj by Molmil](/molmil-images/mine/6usj) | Structure of two nucleosomes bridged by human PARP2 | Descriptor: | Histone H2A, Histone H2B type 1-J, Histone H3.1, ... | Authors: | Gaullier, G, Bowerman, S, Luger, K. | Deposit date: | 2019-10-27 | Release date: | 2020-10-14 | Last modified: | 2024-03-06 | Method: | ELECTRON MICROSCOPY (10.5 Å) | Cite: | Bridging of nucleosome-proximal DNA double-strand breaks by PARP2 enhances its interaction with HPF1. Plos One, 15, 2020
|
|
1ZLA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1zla by Molmil](/molmil-images/mine/1zla) | X-ray Structure of a Kaposi's sarcoma herpesvirus LANA peptide bound to the nucleosomal core | Descriptor: | Histone H4, Palindromic 146bp Human alpha-Satellite DNA fragment, Xenopus laevis-like histone H2A, ... | Authors: | Chodaparambil, J.V, Barbera, A.J, Kaye, K.M, Luger, K. | Deposit date: | 2005-05-05 | Release date: | 2006-02-28 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | The nucleosomal surface as a docking station for Kaposi's sarcoma herpesvirus LANA. Science, 311, 2006
|
|
1YD9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1yd9 by Molmil](/molmil-images/mine/1yd9) | 1.6A Crystal Structure of the Non-Histone Domain of the Histone Variant MacroH2A1.1. | Descriptor: | Core histone macro-H2A.1, GOLD ION | Authors: | Chakravarthy, S, Swamy, G.Y.S.K, Caron, C, Perche, P.Y, Pehrson, J.R, Khochbin, S, Luger, K. | Deposit date: | 2004-12-23 | Release date: | 2005-09-27 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Structural characterization of the histone variant macroH2A Mol.Cell.Biol., 25, 2005
|
|
1EYN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1eyn by Molmil](/molmil-images/mine/1eyn) | Structure of mura liganded with the extrinsic fluorescence probe ANS | Descriptor: | 8-ANILINO-1-NAPHTHALENE SULFONATE, GLYCEROL, UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE | Authors: | Schonbrunn, E, Eschenburg, S, Luger, K, Kabsch, W, Amrhein, N. | Deposit date: | 2000-05-07 | Release date: | 2000-06-09 | Last modified: | 2023-08-09 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Structural basis for the interaction of the fluorescence probe 8-anilino-1-naphthalene sulfonate (ANS) with the antibiotic target MurA. Proc.Natl.Acad.Sci.USA, 97, 2000
|
|
1S32
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1s32 by Molmil](/molmil-images/mine/1s32) | Molecular Recognition of the Nucleosomal 'Supergroove' | Descriptor: | 2-(2-CARBAMOYLMETHOXY-ETHOXY)-ACETAMIDE, 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, ... | Authors: | Edayathumangalam, R.S, Weyermann, P, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2004-01-12 | Release date: | 2004-05-11 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.05 Å) | Cite: | Molecular Recognition of the Nucleosomal 'Supergroove' Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
1U35
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1u35 by Molmil](/molmil-images/mine/1u35) | Crystal structure of the nucleosome core particle containing the histone domain of macroH2A | Descriptor: | H2A histone family, Hist1h4i protein, Histone H3.1, ... | Authors: | Chakravarthy, S, Gundimella, S.K, Caron, C, Perche, P.Y, Pehrson, J.R, Khochbin, S, Luger, K. | Deposit date: | 2004-07-20 | Release date: | 2005-09-27 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Structural characterization of the histone variant macroH2A. Mol.Cell.Biol., 25, 2005
|
|
1KX4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx4 by Molmil](/molmil-images/mine/1kx4) | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|