1D3X
| INTRAMOLECULAR DNA TRIPLEX, NMR, 10 STRUCTURES | Descriptor: | DNA (5'-D(*AP*GP*AP*GP*AP*GP*AP*A)-3'), DNA (5'-D(*TP*CP*TP*CP*TP*CP*TP*T)-3'), DNA (5'-D(*TP*TP*CP*TP*CP*TP*CP*T)-3') | Authors: | Tarkoy, M, Phipps, A.K, Schultze, P, Feigon, J. | Deposit date: | 1998-02-05 | Release date: | 1998-05-06 | Last modified: | 2022-02-16 | Method: | SOLUTION NMR | Cite: | Solution structure of an intramolecular DNA triplex linked by hexakis(ethylene glycol) units: d(AGAGAGAA-(EG)6-TTCTCTCT-(EG)6-TCTCTCTT). Biochemistry, 37, 1998
|
|
1K4X
| POTASSIUM FORM OF OXY-1.5 QUADRUPLEX DNA | Descriptor: | DNA (5'-D(*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*G)-3') | Authors: | Schultze, P, Hud, N.V, Smith, F.W, Feigon, J. | Deposit date: | 1999-06-08 | Release date: | 1999-06-23 | Last modified: | 2023-12-27 | Method: | SOLUTION NMR | Cite: | The effect of sodium, potassium and ammonium ions on the conformation of the dimeric quadruplex formed by the Oxytricha nova telomere repeat oligonucleotide d(G(4)T(4)G(4)). Nucleic Acids Res., 27, 1999
|
|
1F4I
| SOLUTION STRUCTURE OF THE HHR23A UBA(2) MUTANT P333E, DEFICIENT IN BINDING THE HIV-1 ACCESSORY PROTEIN VPR | Descriptor: | UV EXCISION REPAIR PROTEIN PROTEIN RAD23 HOMOLOG A | Authors: | Withers-Ward, E.S, Mueller, T.D, Chen, I.S, Feigon, J. | Deposit date: | 2000-06-07 | Release date: | 2000-12-20 | Last modified: | 2021-11-03 | Method: | SOLUTION NMR | Cite: | Biochemical and structural analysis of the interaction between the UBA(2) domain of the DNA repair protein HHR23A and HIV-1 Vpr. Biochemistry, 39, 2000
|
|
1IE2
| Solution Structure of an In Vitro Selected RNA which is Sequence Specifically Recognized by RBD12 of Hamster Nucleolin.sNRE (anti) | Descriptor: | 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*CP*GP*AP*AP*GP*UP*AP*GP*GP*CP*C)-3' | Authors: | Bouvet, P, Allain, F.H.-T, Finger, L.D, Dieckmann, T, Feigon, J. | Deposit date: | 2001-04-05 | Release date: | 2001-06-20 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | Recognition of pre-formed and flexible elements of an RNA stem-loop by nucleolin. J.Mol.Biol., 309, 2001
|
|
2K96
| Solution structure of the RDC-refined P2B-P3 pseudoknot from human telomerase RNA (delta U177) | Descriptor: | TELOMERASE RNA P2B-P3 PSEUDOKNOT | Authors: | Kim, N.-K, Zhang, Q, Zhou, J, Theimer, C.A, Peterson, R.D, Feigon, J. | Deposit date: | 2008-09-29 | Release date: | 2008-11-25 | Last modified: | 2022-03-16 | Method: | SOLUTION NMR | Cite: | Solution Structure and Dynamics of the Wild-type Pseudoknot of Human Telomerase RNA. J.Mol.Biol., 384, 2008
|
|
1K4B
| STRUCTURE OF AGUU RNA TETRALOOP, NMR, 20 STRUCTURES | Descriptor: | 5'-R(*GP*GP*UP*UP*CP*AP*GP*UP*UP*GP*AP*AP*CP*C)-3' | Authors: | Wu, H, Yang, P.K, Butcher, S.E, Kang, S, Chanfreau, G, Feigon, J. | Deposit date: | 2001-10-07 | Release date: | 2001-12-19 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | A novel family of RNA tetraloop structure forms the recognition site for Saccharomyces cerevisiae RNase III. EMBO J., 20, 2001
|
|
1K4A
| STRUCTURE OF AGAA RNA TETRALOOP, NMR, 20 STRUCTURES | Descriptor: | 5'-R(*GP*GP*UP*UP*CP*AP*GP*AP*AP*GP*AP*AP*CP*C)-3' | Authors: | Wu, H, Yang, P.K, Butcher, S.E, Kang, S, Chanfreau, G, Feigon, J. | Deposit date: | 2001-10-07 | Release date: | 2001-12-19 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | A novel family of RNA tetraloop structure forms the recognition site for Saccharomyces cerevisiae RNase III. EMBO J., 20, 2001
|
|
1Q75
| |
1P9D
| |
1P9C
| |
1GN7
| |
1TLR
| |
1EBR
| |
1EBS
| |
1FJ7
| |
1FJC
| |
1LWM
| Solution Structure of the Sequence-Non-Specific HMGB protein NHP6A | Descriptor: | NONHISTONE CHROMOSOMAL PROTEIN 6A | Authors: | Masse, J.E, Wong, B, Yen, Y.-M, Allain, F.H.-T, Johnson, R.C, Feigon, J. | Deposit date: | 2002-05-31 | Release date: | 2002-10-16 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | The S. cerevisiae architectural HMGB protein NHP6A complexed with DNA: DNA and protein conformational changes upon binding J.Mol.Biol., 323, 2002
|
|
1LWA
| Solution Structure of SRY_DNA | Descriptor: | 5'-D(*CP*TP*GP*AP*AP*CP*AP*AP*TP*CP*AP*CP*CP*CP*C)-3', 5'-D(*GP*GP*GP*GP*TP*GP*AP*TP*TP*GP*TP*TP*CP*AP*G)-3' | Authors: | Masse, J.E, Wong, B, Yen, Y.-M, Allain, F.H.-T, Johnson, R.C, Feigon, J. | Deposit date: | 2002-05-30 | Release date: | 2002-10-16 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | The S. cerevisiae architectural HMGB protein NHP6A complexed with DNA: DNA and protein conformational changes upon binding J.Mol.Biol., 323, 2002
|
|
1J5N
| Solution Structure of the Non-Sequence-Specific HMGB protein NHP6A in complex with SRY DNA | Descriptor: | 5'-D(*CP*TP*GP*AP*AP*CP*AP*AP*TP*CP*AP*CP*CP*CP*C)-3', 5'-D(*GP*GP*GP*GP*TP*GP*AP*TP*TP*GP*TP*TP*CP*AP*G)-3', Nonhistone chromosomal protein 6A | Authors: | Masse, J.E, Wong, B, Yen, Y.-M, Allain, F.H.-T, Johnson, R.C, Feigon, J. | Deposit date: | 2002-05-15 | Release date: | 2002-10-16 | Last modified: | 2023-12-27 | Method: | SOLUTION NMR | Cite: | The S. cerevisiae architectural HMGB protein NHP6A complexed with DNA: DNA and protein conformational changes upon binding J.Mol.Biol., 323, 2002
|
|
2LBS
| Solution structure of double-stranded RNA binding domain of S. cerevisiae RNase III (Rnt1p) in complex with AAGU tetraloop hairpin | Descriptor: | RNA (32-MER), Ribonuclease 3 | Authors: | Wang, Z, Hartman, E, Roy, K, Chanfreau, G, Feigon, J. | Deposit date: | 2011-04-06 | Release date: | 2011-08-31 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Structure of a Yeast RNase III dsRBD Complex with a Noncanonical RNA Substrate Provides New Insights into Binding Specificity of dsRBDs. Structure, 19, 2011
|
|
2LUP
| |
2LUQ
| |
1QWB
| |
1QWA
| NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Descriptor: | 18S ribosomal RNA, 5'ETS | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | Deposit date: | 2003-09-01 | Release date: | 2003-11-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
|
|
1RVH
| SOLUTION STRUCTURE OF THE DNA DODECAMER GCAAAATTTTGC | Descriptor: | 5'-D(*GP*CP*AP*AP*AP*AP*TP*TP*TP*TP*GP*C)-3' | Authors: | Stefl, R, Wu, H, Ravindranathan, S, Sklenar, V, Feigon, J. | Deposit date: | 2003-12-13 | Release date: | 2004-02-10 | Last modified: | 2022-03-02 | Method: | SOLUTION NMR | Cite: | DNA A-tract bending in three dimensions: Solving the dA4T4 vs. dT4A4 conundrum. Proc.Natl.Acad.Sci.USA, 101, 2004
|
|