1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX3
| X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX4
| X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
4WU8
| Structure of trPtNAP-NCP145 | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | Authors: | Chua, E.Y.D, Davey, C.A. | Deposit date: | 2014-10-31 | Release date: | 2015-09-02 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.45 Å) | Cite: | Stereochemical control of nucleosome targeting by platinum-intercalator antitumor agents. Nucleic Acids Res., 43, 2015
|
|
4KGC
| Nucleosome Core Particle Containing (ETA6-P-CYMENE)-(1, 2-ETHYLENEDIAMINE)-RUTHENIUM | Descriptor: | (ethane-1,2-diamine-kappa~2~N,N')[(1,2,3,4,5,6-eta)-1-methyl-4-(propan-2-yl)cyclohexane-1,2,3,4,5,6-hexayl]ruthenium, DNA (145-mer), Histone H2A, ... | Authors: | Adhireksan, Z, Davey, C.A. | Deposit date: | 2013-04-29 | Release date: | 2014-03-26 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.69 Å) | Cite: | Ligand substitutions between ruthenium-cymene compounds can control protein versus DNA targeting and anticancer activity Nat Commun, 5, 2014
|
|
8QKT
| |
3B6F
| |
3B6G
| |
7COW
| 353 bp di-nucleosome harboring cohesive DNA termini with linker histone H1.0 | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (353-MER), ... | Authors: | Adhireksan, Z, Sharma, D, Lee, P.L, Davey, C.A. | Deposit date: | 2020-08-05 | Release date: | 2021-08-11 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.86 Å) | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies. Nucleic Acids Res., 49, 2021
|
|
6JXD
| |
6K1I
| Human nucleosome core particle with gammaH2A.X variant | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2AX, ... | Authors: | Sharma, D, De Falco, L, Davey, C.A. | Deposit date: | 2019-05-10 | Release date: | 2020-01-15 | Last modified: | 2024-03-27 | Method: | X-RAY DIFFRACTION (2.75 Å) | Cite: | PARP1 exhibits enhanced association and catalytic efficiency with gamma H2A.X-nucleosome. Nat Commun, 10, 2019
|
|
6K1K
| Human nucleosome core particle with H2A.X S139E variant | Descriptor: | CHLORIDE ION, DNA (145-MER), Histone H2AX, ... | Authors: | Sharma, D, De Falco, L, Davey, C.A. | Deposit date: | 2019-05-10 | Release date: | 2020-01-15 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | PARP1 exhibits enhanced association and catalytic efficiency with gamma H2A.X-nucleosome. Nat Commun, 10, 2019
|
|
6K1J
| Human nucleosome core particle with H2A.X variant | Descriptor: | CHLORIDE ION, DNA (145-MER), Histone H2AX, ... | Authors: | Sharma, D, De Falco, L, Davey, C.A. | Deposit date: | 2019-05-10 | Release date: | 2020-01-15 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.85 Å) | Cite: | PARP1 exhibits enhanced association and catalytic efficiency with gamma H2A.X-nucleosome. Nat Commun, 10, 2019
|
|
8YTI
| Crystal Structure of Nucleosome-H1x Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (169-MER), ... | Authors: | Adhireksan, Z, Qiuye, B, Padavattan, S, Davey, C.A. | Deposit date: | 2024-03-26 | Release date: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Linker Histones Associate Heterogeneously with Nucleosomes in the Condensed State To Be Published
|
|
5XF5
| Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (R,S-configuration) | Descriptor: | (1S,2R)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.82 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
5XF6
| Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having an ethylenediamine linker | Descriptor: | DNA (145-MER), ETHANE-1,2-DIAMINE, Histone H2A, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.63 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
5XF4
| Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (S,S-configuration) | Descriptor: | (1S,2S)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.87 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
5XF3
| Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (R,R-configuration) | Descriptor: | (1R,2R)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
7XX6
| Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, DNA (169-MER), Histone H1.0, ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-28 | Release date: | 2023-05-31 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (3.39 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) To Be Published
|
|
7XVM
| Crystal Structure of Nucleosome-H5 Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (169-MER), ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-24 | Release date: | 2023-05-24 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.84 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) To Be Published
|
|
7XX5
| Crystal Structure of Nucleosome-H1.3 Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, DNA (169-MER), Histone H1.3, ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-28 | Release date: | 2023-05-31 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (3.19 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) To Be Published
|
|
7XVL
| Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169an DNA fragment) | Descriptor: | DNA (169-MER), Histone H1.0, Histone H2A type 1-B/E, ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-24 | Release date: | 2023-05-24 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (3.506 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169an DNA fragment) To Be Published
|
|
3LZ1
| Crystal Structure of Nucleosome Core Particle Composed of the Widom 601 DNA Sequence (orientation 2) | Descriptor: | CHLORIDE ION, DNA (145-MER), Histone H2A, ... | Authors: | Vasudevan, D, Chua, E.Y.D, Davey, C.A. | Deposit date: | 2010-03-01 | Release date: | 2010-09-15 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Crystal structures of nucleosome core particles containing the '601' strong positioning sequence J.Mol.Biol., 403, 2010
|
|
3LZ0
| Crystal Structure of Nucleosome Core Particle Composed of the Widom 601 DNA Sequence (orientation 1) | Descriptor: | CHLORIDE ION, DNA (145-MER), Histone H2A, ... | Authors: | Vasudevan, D, Chua, E.Y.D, Davey, C.A. | Deposit date: | 2010-03-01 | Release date: | 2010-09-15 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Crystal structures of nucleosome core particles containing the '601' strong positioning sequence J.Mol.Biol., 403, 2010
|
|
3MGR
| Binding of Rubidium ions to the Nucleosome Core Particle | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | Deposit date: | 2010-04-07 | Release date: | 2010-06-16 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Perturbations in nucleosome structure from heavy metal association. Nucleic Acids Res., 38, 2010
|
|