8E63
 
 | | Crystal structure of SARS-CoV-2 3CL protease in complex with a phenyl sulfane inhibitor | | Descriptor: | (1R,2S)-1-hydroxy-3-[(3S)-2-oxopyrrolidin-3-yl]-2-[(N-{[2-(phenylsulfanyl)ethoxy]carbonyl}-L-leucyl)amino]propane-1-sulfonic acid, 2-phenylsulfanylethyl ~{N}-[(2~{S})-1-[[(1~{S},2~{S})-1-[bis(oxidanyl)-oxidanylidene-$l^{5}-sulfanyl]-1-oxidanyl-3-[(3~{S})-2-oxidanylidenepyrrolidin-3-yl]propan-2-yl]amino]-4-methyl-1-oxidanylidene-pentan-2-yl]carbamate, 3C-like proteinase, ... | | Authors: | Lovell, S, Liu, L, Battaile, K.P, Madden, T.K, Groutas, W.C. | | Deposit date: | 2022-08-22 | | Release date: | 2022-09-28 | | Last modified: | 2024-05-01 | | Method: | X-RAY DIFFRACTION (1.75 Å) | | Cite: | Structure-guided design of direct-acting antivirals that exploit the gem-dimethyl effect and potently inhibit 3CL proteases of severe acute respiratory syndrome Coronavirus-2 (SARS-CoV-2) and middle east respiratory syndrome coronavirus (MERS-CoV).
Eur.J.Med.Chem., 254, 2023
|
|
5B6O
 | | Crystal structure of MS8104 | | Descriptor: | 3C-like proteinase | | Authors: | Wang, H, Kim, Y, Muramatsu, T, Takemoto, C, Shirouzu, M, Yokoyama, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | | Deposit date: | 2016-05-31 | | Release date: | 2016-06-15 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.202 Å) | | Cite: | SARS-CoV 3CL protease cleaves its C-terminal autoprocessing site by novel subsite cooperativity
Proc. Natl. Acad. Sci. U.S.A., 113, 2016
|
|
2GHT
 | |
2HOG
 | | crystal structure of Chek1 in complex with inhibitor 20 | | Descriptor: | (5-{3-[5-(PIPERIDIN-1-YLMETHYL)-1H-INDOL-2-YL]-1H-INDAZOL-6-YL}-2H-1,2,3-TRIAZOL-4-YL)METHANOL, Serine/threonine-protein kinase Chk1 | | Authors: | Yan, Y, Ikuta, M. | | Deposit date: | 2006-07-14 | | Release date: | 2007-04-24 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | 3-(Indol-2-yl)indazoles as Chek1 kinase inhibitors: Optimization of potency and selectivity via substitution at C6.
Bioorg.Med.Chem.Lett., 16, 2006
|
|
2GHQ
 | |
2QSE
 | |
2QR9
 | | Crystal Structure of the Estrogen Receptor Alpha Ligand Binding Domain Complexed with an Oxabicyclic Derivative Compound | | Descriptor: | Estrogen receptor, Nuclear receptor coactivator 2, dimethyl (1R,4S)-5,6-bis(4-hydroxyphenyl)-7-oxabicyclo[2.2.1]hepta-2,5-diene-2,3-dicarboxylate | | Authors: | Nettles, K.W, Bruning, J.B. | | Deposit date: | 2007-07-27 | | Release date: | 2008-03-18 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | NFkappaB selectivity of estrogen receptor ligands revealed by comparative crystallographic analyses
Nat.Chem.Biol., 4, 2008
|
|
4XAU
 | | Crystal structure of AtS13 from Actinomadura melliaura | | Descriptor: | PYRIDOXAL-5'-PHOSPHATE, Putative aminotransferase | | Authors: | Wang, F, Singh, S, Xu, W, Thorson, J.S, Phillips Jr, G.N, Enzyme Discovery for Natural Product Biosynthesis (NatPro) | | Deposit date: | 2014-12-15 | | Release date: | 2014-12-24 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (3.0012 Å) | | Cite: | Structural characterization of AtmS13, a putative sugar aminotransferase involved in indolocarbazole AT2433 aminopentose biosynthesis.
Proteins, 83, 2015
|
|
4WKY
 | | Streptomcyes albus JA3453 oxazolomycin ketosynthase domain OzmN KS2 | | Descriptor: | 1,2-ETHANEDIOL, Beta-ketoacyl synthase, GLYCEROL, ... | | Authors: | Cuff, M.E, Mack, J.C, Endres, M, Babnigg, G, Bingman, C.A, Yennamalli, R, Lohman, J.R, Ma, M, Shen, B, Phillips Jr, G.N, Joachimiak, A, Midwest Center for Structural Genomics (MCSG), Enzyme Discovery for Natural Product Biosynthesis (NatPro) | | Deposit date: | 2014-10-03 | | Release date: | 2014-10-29 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Structural and evolutionary relationships of "AT-less" type I polyketide synthase ketosynthases.
Proc.Natl.Acad.Sci.USA, 112, 2015
|
|
3L0C
 | |
6CSM
 | | Crystal structure of the natural light-gated anion channel GtACR1 | | Descriptor: | GtACR1, OLEIC ACID, RETINAL | | Authors: | Kato, H.E, Kim, Y, Yamashita, K, Kobilka, B.K, Deisseroth, K. | | Deposit date: | 2018-03-21 | | Release date: | 2018-09-05 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structural mechanisms of selectivity and gating in anion channelrhodopsins.
Nature, 561, 2018
|
|
3L0B
 | | Crystal structure of SCP1 phosphatase D206A mutant phosphoryl-intermediate | | Descriptor: | 2-(2-{2-[2-(2-METHOXY-ETHOXY)-ETHOXY]-ETHOXY}-ETHOXY)-ETHANOL, Carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 1, MAGNESIUM ION | | Authors: | Zhang, M, Zhang, Y. | | Deposit date: | 2009-12-09 | | Release date: | 2010-03-23 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Structural and functional analysis of the phosphoryl transfer reaction mediated by the human small C-terminal domain phosphatase, Scp1.
Protein Sci., 19, 2010
|
|
3L0Y
 | | Crystal structure OF SCP1 phosphatase D98A mutant | | Descriptor: | Carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 1, MAGNESIUM ION | | Authors: | Zhang, M, Zhang, Y. | | Deposit date: | 2009-12-10 | | Release date: | 2010-03-23 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structural and functional analysis of the phosphoryl transfer reaction mediated by the human small C-terminal domain phosphatase, Scp1.
Protein Sci., 19, 2010
|
|
6CSO
 | | Crystal structure of the designed light-gated anion channel iC++ at pH6.5 | | Descriptor: | OLEIC ACID, RETINAL, iC++ | | Authors: | Kato, H.E, Kim, Y, Yamashita, K, Kobilka, B.K, Deisseroth, K. | | Deposit date: | 2018-03-21 | | Release date: | 2018-09-05 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structural mechanisms of selectivity and gating in anion channelrhodopsins.
Nature, 561, 2018
|
|
5HJS
 | | Identification of LXRbeta selective agonists for the treatment of Alzheimer's Disease | | Descriptor: | 2-chloro-4-{1'-[(2R)-2-hydroxy-3-methyl-2-(trifluoromethyl)butanoyl]-4,4'-bipiperidin-1-yl}-N,N-dimethylbenzamide, Nuclear receptor coactivator 1, Oxysterols receptor LXR-alpha, ... | | Authors: | Parthasarathy, G, Klein, D. | | Deposit date: | 2016-01-13 | | Release date: | 2016-04-06 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (1.72 Å) | | Cite: | Identification and in Vivo Evaluation of Liver X Receptor beta-Selective Agonists for the Potential Treatment of Alzheimer's Disease.
J.Med.Chem., 59, 2016
|
|
6CSN
 | | Crystal structure of the designed light-gated anion channel iC++ at pH8.5 | | Descriptor: | CHLORIDE ION, OLEIC ACID, RETINAL, ... | | Authors: | Kato, H.E, Kim, Y, Yamashita, K, Kobilka, B.K, Deisseroth, K. | | Deposit date: | 2018-03-21 | | Release date: | 2018-09-05 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structural mechanisms of selectivity and gating in anion channelrhodopsins.
Nature, 561, 2018
|
|
5HJP
 | | Identification of LXRbeta selective agonists for the treatment of Alzheimer's Disease | | Descriptor: | 2-chloro-4-{1'-[(2R)-2-hydroxy-3-methyl-2-(trifluoromethyl)butanoyl]-4,4'-bipiperidin-1-yl}-N,N-dimethylbenzamide, DI(HYDROXYETHYL)ETHER, Oxysterols receptor LXR-beta, ... | | Authors: | Parthasarathy, G, Klein, D. | | Deposit date: | 2016-01-13 | | Release date: | 2016-04-06 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Identification and in Vivo Evaluation of Liver X Receptor beta-Selective Agonists for the Potential Treatment of Alzheimer's Disease.
J.Med.Chem., 59, 2016
|
|
4P0P
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0Q
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.851 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0S
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0R
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6.501 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
5U2D
 | | Crystal Structure of the ER-alpha Ligand-binding Domain (Y537S) in complex with Oxabicyclic Heptene Sulfonate (OBHS) | | Descriptor: | Estrogen receptor, Nuclear receptor coactivator 2, cyclohexa-2,5-dien-1-yl (1S,2R,4S)-5,6-bis(4-hydroxyphenyl)-7-oxabicyclo[2.2.1]hept-5-ene-2-sulfonate | | Authors: | Nwachukwu, J.C, Erumbi, R, Nowak, J, Carlson, K.E, Katzenellenbogen, J.A, Izard, T, Nettles, K.W. | | Deposit date: | 2016-11-30 | | Release date: | 2017-04-05 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (1.86 Å) | | Cite: | Structural and Molecular Mechanisms of Cytokine-Mediated Endocrine Resistance in Human Breast Cancer Cells.
Mol. Cell, 65, 2017
|
|
5U2B
 | | Crystal Structure of the ER-alpha Ligand-binding Domain (Y537S) in Complex with the phenylamino-substituted estrogen, (8R,9S,13S,14S,17S)-13-methyl-17-(phenylamino)-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-ol, without a coactivator peptide | | Descriptor: | (8~{R},9~{S},13~{S},14~{S},17~{S})-13-methyl-17-phenylazanyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-3-ol, Estrogen receptor | | Authors: | Nwachukwu, J.C, Nowak, J, Carlson, K.E, Katzenellenbogen, J.A, Nettles, K.W. | | Deposit date: | 2016-11-30 | | Release date: | 2017-04-26 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.22 Å) | | Cite: | Structural and Molecular Mechanisms of Cytokine-Mediated Endocrine Resistance in Human Breast Cancer Cells.
Mol. Cell, 65, 2017
|
|
5TEU
 | | Brucella periplasmic binding protein YehZ | | Descriptor: | ACETATE ION, L(+)-TARTARIC ACID, SULFATE ION, ... | | Authors: | Herrou, J, Crosson, S. | | Deposit date: | 2016-09-22 | | Release date: | 2017-01-11 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (1.62 Å) | | Cite: | Conserved ABC Transport System Regulated by the General Stress Response Pathways of Alpha- and Gammaproteobacteria.
J. Bacteriol., 199, 2017
|
|
6WZU
 | | The crystal structure of Papain-Like Protease of SARS CoV-2 , P3221 space group | | Descriptor: | CHLORIDE ION, GLYCEROL, Non-structural protein 3, ... | | Authors: | Osipiuk, J, Tesar, C, Endres, M, Jedrzejczak, R, Joachimiak, A, Center for Structural Genomics of Infectious Diseases (CSGID) | | Deposit date: | 2020-05-14 | | Release date: | 2020-05-27 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (1.79 Å) | | Cite: | Structure of papain-like protease from SARS-CoV-2 and its complexes with non-covalent inhibitors.
Nat Commun, 12, 2021
|
|
