8C9D
 
 | | Priestia megaterium W130Q mutant of type 2 isoleucyl-tRNA synthetase complexed with an isoleucyl-adenylate analogue | | Descriptor: | D(-)-TARTARIC ACID, Isoleucine--tRNA ligase, N-[ISOLEUCINYL]-N'-[ADENOSYL]-DIAMINOSUFONE, ... | | Authors: | Brkic, A, Leibundgut, M, Jablonska, J, Zanki, V, Car, Z, Petrovic Perokovic, V, Ban, N, Gruic-Sovulj, I. | | Deposit date: | 2023-01-21 | | Release date: | 2023-08-16 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Antibiotic hyper-resistance in a class I aminoacyl-tRNA synthetase with altered active site signature motif.
Nat Commun, 14, 2023
|
|
8C9F
 | | Priestia megaterium inactive HIGH motif mutant of type1 isoleucyl-tRNA synthetase complexed with an isoleucyl-adenylate analogue. | | Descriptor: | CHLORIDE ION, Isoleucine--tRNA ligase, LITHIUM ION, ... | | Authors: | Brkic, A, Leibundgut, M, Jablonska, J, Zanki, V, Car, Z, Petrovic Perokovic, V, Ban, N, Gruic-Sovulj, I. | | Deposit date: | 2023-01-21 | | Release date: | 2023-08-16 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Antibiotic hyper-resistance in a class I aminoacyl-tRNA synthetase with altered active site signature motif.
Nat Commun, 14, 2023
|
|
8C8V
 | | Priestia megaterium mupirocin-resistant isoleucyl-tRNA synthetase 2 with a fully-resolved C-terminal tRNA-binding domain complexed with an isoleucyl-adenylate analogue | | Descriptor: | D(-)-TARTARIC ACID, Isoleucine--tRNA ligase, N-[ISOLEUCINYL]-N'-[ADENOSYL]-DIAMINOSUFONE, ... | | Authors: | Brkic, A, Leibundgut, M, Jablonska, J, Zanki, V, Car, Z, Petrovic Perokovic, V, Ban, N, Gruic-Sovulj, I. | | Deposit date: | 2023-01-21 | | Release date: | 2023-08-16 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Antibiotic hyper-resistance in a class I aminoacyl-tRNA synthetase with altered active site signature motif.
Nat Commun, 14, 2023
|
|
8C9E
 | | Priestia megaterium mupirocin-sensitive isoleucyl-tRNA synthetase 1 complexed with an isoleucyl-adenylate analogue | | Descriptor: | CHLORIDE ION, Isoleucine--tRNA ligase, LITHIUM ION, ... | | Authors: | Brkic, A, Leibundgut, M, Jablonska, J, Zanki, V, Car, Z, Petrovic Perokovic, V, Ban, N, Gruic-Sovulj, I. | | Deposit date: | 2023-01-21 | | Release date: | 2023-08-16 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Antibiotic hyper-resistance in a class I aminoacyl-tRNA synthetase with altered active site signature motif.
Nat Commun, 14, 2023
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
6SJ9
 | | Proteasome accessory factor B/C (PafBC) of Arthrobacter aurescens | | Descriptor: | DI(HYDROXYETHYL)ETHER, POTASSIUM ION, Proteasome accessory factor B/C (PafBC), ... | | Authors: | Mueller, A.U, Leibundgut, M, Ban, N, Weber-Ban, E. | | Deposit date: | 2019-08-13 | | Release date: | 2019-10-16 | | Last modified: | 2019-10-23 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structure and functional implications of WYL domain-containing bacterial DNA damage response regulator PafBC.
Nat Commun, 10, 2019
|
|
4V1A
 | | Structure of the large subunit of the mammalian mitoribosome, part 2 of 2 | | Descriptor: | MITORIBOSOMAL PROTEIN ML37, MRPL37, MITORIBOSOMAL PROTEIN ML38, ... | | Authors: | Greber, B.J, Boehringer, D, Leibundgut, M, Bieri, P, Leitner, A, Schmitz, N, Aebersold, R, Ban, N. | | Deposit date: | 2014-09-25 | | Release date: | 2014-10-08 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (3.4 Å) | | Cite: | The Complete Structure of the Large Subunit of the Mammalian Mitochondrial Ribosome
Nature, 515, 2014
|
|
4V19
 | | Structure of the large subunit of the mammalian mitoribosome, part 1 of 2 | | Descriptor: | MAGNESIUM ION, MITORIBOSOMAL 16S RRNA, MITORIBOSOMAL CP TRNA, ... | | Authors: | Greber, B.J, Boehringer, D, Leibundgut, M, Bieri, P, Leitner, A, Schmitz, N, Aebersold, R, Ban, N. | | Deposit date: | 2014-09-25 | | Release date: | 2014-10-08 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (3.4 Å) | | Cite: | The Complete Structure of the Large Subunit of the Mammalian Mitochondrial Ribosome
Nature, 515, 2014
|
|
4V59
 | | Crystal structure of fatty acid synthase complexed with nadp+ from thermomyces lanuginosus at 3.1 angstrom resolution. | | Descriptor: | FATTY ACID SYNTHASE ALPHA SUBUNITS, FATTY ACID SYNTHASE BETA SUBUNITS, FLAVIN MONONUCLEOTIDE, ... | | Authors: | Jenni, S, Leibundgut, M, Boehringer, D, Frick, C, Mikolasek, B, Ban, N. | | Deposit date: | 2007-03-09 | | Release date: | 2014-07-09 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structure of Fungal Fatty Acid Synthase and Implications for Iterative Substrate Shuttling
Science, 316, 2007
|
|
4V8T
 | | Cryo-EM Structure of the 60S Ribosomal Subunit in Complex with Arx1 and Rei1 | | Descriptor: | 25S RIBOSOMAL RNA, 5.8S RIBOSOMAL RNA, 5S RIBOSOMAL RNA, ... | | Authors: | Greber, B.J, Boehringer, D, Montellese, C, Ban, N. | | Deposit date: | 2012-08-07 | | Release date: | 2014-07-09 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (8.1 Å) | | Cite: | Cryo-Em Structures of Arx1 and Maturation Factors Rei1 and Jjj1 Bound to the 60S Ribosomal Subunit
Nat.Struct.Mol.Biol., 19, 2012
|
|
4V5B
 | | Structure of PDF binding helix in complex with the ribosome. | | Descriptor: | 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, ... | | Authors: | Bingel-Erlenmeyer, R, Kohler, R, Kramer, G, Sandikci, A, Antolic, S, Maier, T, Schaffitzel, C, Wiedmann, B, Bukau, B, Ban, N. | | Deposit date: | 2007-11-22 | | Release date: | 2014-07-09 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.74 Å) | | Cite: | A Peptide Deformylase-Ribosome Complex Reveals Mechanism of Nascent Chain Processing.
Nature, 452, 2008
|
|
4V8L
 | |
1K8A
 | | Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T. | | Deposit date: | 2001-10-23 | | Release date: | 2002-07-19 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit.
Mol.Cell, 10, 2002
|
|
4UER
 | | 40S-eIF1-eIF1A-eIF3-eIF3j translation initiation complex from Lachancea kluyveri | | Descriptor: | 18S RRNA, EIF1, EIF1A, ... | | Authors: | Aylett, C.H.S, Boehringer, D, Erzberger, J.P, Schaefer, T, Ban, N. | | Deposit date: | 2014-12-18 | | Release date: | 2015-02-11 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (6.47 Å) | | Cite: | Structure of a Yeast 40S-Eif1-Eif1A-Eif3-Eif3J Initiation Complex
Nat.Struct.Mol.Biol., 22, 2015
|
|
4V8P
 | | T.thermophila 60S ribosomal subunit in complex with initiation factor 6. | | Descriptor: | 26S RRNA, 5.8S RRNA, 5S RRNA, ... | | Authors: | Klinge, S, Voigts-Hoffmann, F, Leibundgut, M, Arpagaus, S, Ban, N. | | Deposit date: | 2011-09-14 | | Release date: | 2014-07-09 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.52 Å) | | Cite: | Crystal Structure of the Eukaryotic 60S Ribosomal Subunit in Complex with Initiation Factor 6.
Science, 334, 2011
|
|
4V5O
 | | CRYSTAL STRUCTURE OF THE EUKARYOTIC 40S RIBOSOMAL SUBUNIT IN COMPLEX WITH INITIATION FACTOR 1. | | Descriptor: | 18S RRNA, 40S RIBOSOMAL PROTEIN S12, 40S RIBOSOMAL PROTEIN S3A, ... | | Authors: | Rabl, J, Leibundgut, M, Ataide, S.F, Haag, A, Ban, N. | | Deposit date: | 2010-11-26 | | Release date: | 2014-07-09 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.93 Å) | | Cite: | Crystal Structure of the Eukaryotic 40S Ribosomal Subunit in Complex with Initiation Factor 1.
Science, 331, 2011
|
|
4V58
 | | Crystal structure of fatty acid synthase from thermomyces lanuginosus at 3.1 angstrom resolution. | | Descriptor: | FATTY ACID SYNTHASE ALPHA SUBUNITS, FATTY ACID SYNTHASE BETA SUBUNITS, FLAVIN MONONUCLEOTIDE | | Authors: | Jenni, S, Leibundgut, M, Boehringer, D, Frick, C, Mikolasek, B, Ban, N. | | Deposit date: | 2007-03-09 | | Release date: | 2014-07-09 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structure of Fungal Fatty Acid Synthase and Implications for Iterative Substrate Shuttling
Science, 316, 2007
|
|
3MF1
 | | Crystal structure of class II aaRS homologue (Bll0957) complexed with an analogue of glycyl adenylate | | Descriptor: | 5'-O-(glycylsulfamoyl)adenosine, Bll0957 protein, ZINC ION | | Authors: | Weygand-Durasevic, I, Mocibob, M, Ivic, N, Bilokapic, S, Maier, T, Luic, M, Ban, N. | | Deposit date: | 2010-04-01 | | Release date: | 2010-07-28 | | Last modified: | 2017-11-08 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Homologs of aminoacyl-tRNA synthetases acylate carrier proteins and provide a link between ribosomal and nonribosomal peptide synthesis
Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
5LFQ
 | | Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis (space group P3) | | Descriptor: | Bacterial proteasome activator | | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-07-04 | | Release date: | 2016-11-23 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.503 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
5LFJ
 | | Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis | | Descriptor: | Bacterial proteasome activator | | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-07-01 | | Release date: | 2016-11-23 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
4B0S
 | | Structure of the Deamidase-Depupylase Dop of the Prokaryotic Ubiquitin-like Modification Pathway in Complex with ATP | | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, DEAMIDASE-DEPUPYLASE DOP, MAGNESIUM ION | | Authors: | Ozcelik, D, Barandun, J, Schmitz, N, Sutter, M, Guth, E, Damberger, F.F, Allain, F.H.-T, Ban, N, Weber-Ban, E. | | Deposit date: | 2012-07-04 | | Release date: | 2012-09-12 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway.
Nat.Commun., 3, 2012
|
|
5APO
 | | Structure of the yeast 60S ribosomal subunit in complex with Arx1, Alb1 and C-terminally tagged Rei1 | | Descriptor: | 25S ribosomal RNA, 5.8S ribosomal RNA, 5S ribosomal RNA, ... | | Authors: | Greber, B.J, Gerhardy, S, Leitner, A, Leibundgut, M, Salem, M, Boehringer, D, Leulliot, N, Aebersold, R, Panse, V.G, Ban, N. | | Deposit date: | 2015-09-17 | | Release date: | 2015-12-16 | | Last modified: | 2019-12-18 | | Method: | ELECTRON MICROSCOPY (3.41 Å) | | Cite: | Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.
Cell(Cambridge,Mass.), 164, 2016
|
|
5LRT
 | | Structure of the Deamidase-Depupylase Dop of the Prokaryotic Ubiquitin-like Modification Pathway in Complex with ADP and Phosphate | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, DI(HYDROXYETHYL)ETHER, Depupylase, ... | | Authors: | Bolten, M, Vahlensieck, C, Lipp, C, Leibundgut, M, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-08-19 | | Release date: | 2017-02-01 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Depupylase Dop Requires Inorganic Phosphate in the Active Site for Catalysis.
J. Biol. Chem., 292, 2017
|
|
5LFP
 | | Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis (space group P6322, SeMet) | | Descriptor: | Bacterial proteasome activator | | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-07-04 | | Release date: | 2016-11-23 | | Last modified: | 2016-12-14 | | Method: | X-RAY DIFFRACTION (3.303 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
