1Q7Y
 
 | | Crystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunit | | Descriptor: | 23S ribosomal rna, 50S ribosomal protein L13P, 50S ribosomal protein L14P, ... | | Authors: | Hansen, J.L, Schmeing, T.M, Moore, P.B, Steitz, T.A. | | Deposit date: | 2003-08-20 | | Release date: | 2003-10-07 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structural Insights Into Peptide Bond Formation
Proc.Natl.Acad.Sci.USA, 99, 2002
|
|
1QVG
 | | Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortui | | Descriptor: | 23S ribosomal rna, 50S RIBOSOMAL PROTEIN L10E, 50S ribosomal protein L13P, ... | | Authors: | Schmeing, T.M, Moore, P.B, Steitz, T.A. | | Deposit date: | 2003-08-27 | | Release date: | 2003-11-11 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structures of deacylated tRNA mimics bound to the E site of the large ribosomal subunit
RNA, 9, 2003
|
|
1Q81
 | | Crystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit. | | Descriptor: | 23S ribosomal rna, 50S ribosomal protein L13P, 50S ribosomal protein L14P, ... | | Authors: | Hansen, J.L, Schmeing, T.M, Moore, P.B, Steitz, T.A. | | Deposit date: | 2003-08-20 | | Release date: | 2003-10-07 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.95 Å) | | Cite: | Structural Insights into Peptide Bond Formation
Proc.Natl.Acad.Sci.USA, 99, 2002
|
|
1Q86
 | | Crystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit. | | Descriptor: | 23S ribosomal rna, 50S ribosomal protein L13P, 50S ribosomal protein L14P, ... | | Authors: | Hansen, J.L, Schmeing, T.M, Moore, P.B, Steitz, T.A. | | Deposit date: | 2003-08-20 | | Release date: | 2003-10-07 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structural insights into peptide bond formation.
Proc.Natl.Acad.Sci.USA, 99, 2002
|
|
1QLN
 | | STRUCTURE OF A TRANSCRIBING T7 RNA POLYMERASE INITIATION COMPLEX | | Descriptor: | BACTERIOPHAGE T7 RNA POLYMERASE, DNA (5- D (P*CP*TP*CP*CP*CP*TP*AP*TP*AP*GP*TP*GP*AP*GP*TP*CP*GP*TP* AP*TP*TP*A)-3), DNA (5-D(P*TP*AP*AP*TP*AP*CP*GP*AP*CP*TP*CP*AP*CP*TP*A)-3), ... | | Authors: | Cheetham, G.M.T, Steitz, T.A. | | Deposit date: | 1999-09-01 | | Release date: | 2000-02-04 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structure of a Transcribing T7 RNA Polymerase Initiation Complex
Science, 286, 1999
|
|
1QTQ
 | | GLUTAMINYL-TRNA SYNTHETASE COMPLEXED WITH TRNA AND AN AMINO ACID ANALOG | | Descriptor: | 5'-O-[N-(L-GLUTAMINYL)-SULFAMOYL]ADENOSINE, PROTEIN (GLUTAMINYL-TRNA SYNTHETASE), RNA (TRNA GLN II ), ... | | Authors: | Rath, V.L, Silvian, L.F, Beijer, B, Sproat, B.S, Steitz, T.A. | | Deposit date: | 1998-01-28 | | Release date: | 1998-05-27 | | Last modified: | 2023-08-02 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | How glutaminyl-tRNA synthetase selects glutamine.
Structure, 6, 1998
|
|
1Q82
 | | Crystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunit | | Descriptor: | 23S ribosomal rna, 50S ribosomal protein L13P, 50S ribosomal protein L14P, ... | | Authors: | Hansen, J.L, Schmeing, T.M, Moore, P.B, Steitz, T.A. | | Deposit date: | 2003-08-20 | | Release date: | 2003-10-07 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.98 Å) | | Cite: | Structural Insights Into Peptide Bond Formation
Proc.Natl.Acad.Sci.USA, 99, 2002
|
|
1S72
 | | REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10e, 50S ribosomal protein L11P, ... | | Authors: | Klein, D.J, Schmeing, T.M, Moore, P.B, Steitz, T.A. | | Deposit date: | 2004-01-28 | | Release date: | 2004-06-15 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The Roles of Ribosomal Proteins in the Structure, Assembly and Evolution of the Large Ribosomal Subunit
J.Mol.Biol., 340, 2004
|
|
1QVF
 | | Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortui | | Descriptor: | 23S ribosomal rna, 50S RIBOSOMAL PROTEIN L10E, 50S ribosomal protein L13P, ... | | Authors: | Schmeing, T.M, Moore, P.B, Steitz, T.A. | | Deposit date: | 2003-08-27 | | Release date: | 2003-11-11 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structures of deacylated tRNA mimics bound to the E site of the large ribosomal subunit
RNA, 9, 2003
|
|
1R8A
 | | Crystal Structures of an Archaeal Class I CCA-Adding Enzyme and Its Nucleotide Complexes | | Descriptor: | MANGANESE (II) ION, SODIUM ION, tRNA nucleotidyltransferase | | Authors: | Xiong, Y, Li, F, Wang, J, Weiner, A.M, Steitz, T.A. | | Deposit date: | 2003-10-23 | | Release date: | 2003-12-16 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Crystal structures of an archaeal class I CCA-adding enzyme and its nucleotide complexes
Mol.Cell, 12, 2003
|
|
1R89
 | | Crystal Structures of an Archaeal Class I CCA-Adding Enzyme and Its Nucleotide Complexes | | Descriptor: | CHLORIDE ION, CYTIDINE-5'-TRIPHOSPHATE, MAGNESIUM ION, ... | | Authors: | Xiong, Y, Li, F, Wang, J, Weiner, A.M, Steitz, T.A. | | Deposit date: | 2003-10-23 | | Release date: | 2003-12-16 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Crystal structures of an archaeal class I CCA-adding enzyme and its nucleotide complexes
Mol.Cell, 12, 2003
|
|
1S77
 | | T7 RNAP product pyrophosphate elongation complex | | Descriptor: | DNA (5'-D(*GP*CP*CP*GP*TP*GP*CP*GP*CP*AP*TP*TP*CP*GP*CP*CP*GP*TP*GP*TP*T)-3'), DNA (5'-D(*TP*TP*TP*AP*CP*GP*TP*TP*GP*CP*GP*CP*AP*CP*GP*GP*C)-3'), DNA-directed RNA polymerase, ... | | Authors: | Yin, Y.W, Steitz, T.A. | | Deposit date: | 2004-01-29 | | Release date: | 2004-03-23 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.69 Å) | | Cite: | The structural mechanism of translocation and helicase activity in T7 RNA polymerase.
Cell(Cambridge,Mass.), 116, 2004
|
|
1S76
 | | T7 RNA polymerase alpha beta methylene ATP elongation complex | | Descriptor: | DIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER, DNA (5'-D(P*GP*CP*CP*GP*TP*GP*CP*GP*CP*AP*TP*TP*CP*GP*CP*CP*GP*TP*GP*TP*T)-3'), DNA (5'-D(P*TP*TP*TP*AP*CP*GP*TP*TP*GP*CP*GP*CP*AP*CP*GP*GP*C)-3'), ... | | Authors: | Yin, Y.W, Steitz, T.A. | | Deposit date: | 2004-01-29 | | Release date: | 2004-03-23 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.88 Å) | | Cite: | The structural mechanism of translocation and helicase activity in T7 RNA polymerase.
Cell(Cambridge,Mass.), 116, 2004
|
|
1RMD
 | | RAG1 DIMERIZATION DOMAIN | | Descriptor: | RAG1, ZINC ION | | Authors: | Bellon, S.F, Rodgers, K.K, Schatz, D.G, Coleman, J.E, Steitz, T.A. | | Deposit date: | 1997-01-10 | | Release date: | 1997-07-23 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Crystal structure of the RAG1 dimerization domain reveals multiple zinc-binding motifs including a novel zinc binuclear cluster.
Nat.Struct.Biol., 4, 1997
|
|
1TFW
 | |
1TLF
 | |
1R8B
 | | Crystal Structures of an Archaeal Class I CCA-Adding Enzyme and Its Nucleotide | | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, CHLORIDE ION, MAGNESIUM ION, ... | | Authors: | Xiong, Y, Li, F, Wang, J, Weiner, A.M, Steitz, T.A. | | Deposit date: | 2003-10-23 | | Release date: | 2003-12-16 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal structures of an archaeal class I CCA-adding enzyme and its nucleotide complexes
Mol.Cell, 12, 2003
|
|
1SZ1
 | |
1TFY
 | |
2KZM
 | | KLENOW FRAGMENT WITH NORMAL SUBSTRATE AND ZINC AND MANGANESE | | Descriptor: | DNA (5'-D(*GP*CP*TP*TP*A*CP*GP*C)-3'), MANGANESE (II) ION, PROTEIN (DNA POLYMERASE I), ... | | Authors: | Brautigam, C.A, Sun, S, Piccirilli, J.A, Steitz, T.A. | | Deposit date: | 1998-07-03 | | Release date: | 1999-02-16 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structures of normal single-stranded DNA and deoxyribo-3'-S-phosphorothiolates bound to the 3'-5' exonucleolytic active site of DNA polymerase I from Escherichia coli.
Biochemistry, 38, 1999
|
|
2KZZ
 | | KLENOW FRAGMENT WITH NORMAL SUBSTRATE AND ZINC ONLY | | Descriptor: | DNA (5'-D(*GP*CP*TP*T*AP*CP*G)-3'), PROTEIN (DNA POLYMERASE I), ZINC ION | | Authors: | Brautigam, C.A, Sun, S, Piccirilli, J.A, Steitz, T.A. | | Deposit date: | 1998-07-07 | | Release date: | 1999-12-14 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | Structures of normal single-stranded DNA and deoxyribo-3'-S-phosphorothiolates bound to the 3'-5' exonucleolytic active site of DNA polymerase I from Escherichia coli.
Biochemistry, 38, 1999
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
3CFP
 | | Structure of the replicating complex of a POL Alpha family DNA Polymerase, ternary complex 1 | | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (5'-D(*DAP*DCP*DAP*DGP*DGP*DTP*DAP*DAP*DGP*DCP*DAP*DGP*DTP*DCP*DCP*DGP*DCP*DG)-3'), ... | | Authors: | Wang, J, Klimenko, D, Wang, M, Steitz, T.A, Konigsberg, W.H. | | Deposit date: | 2008-03-04 | | Release date: | 2009-03-10 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Insights into base selectivity from the structures
of an RB69 DNA Polymerase triple mutant
To be Published
|
|
3CFR
 | | Structure of the replicating complex of a POL Alpha family DNA Polymerase, ternary complex 2 | | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (5'-D(*DGP*DCP*DGP*DGP*DAP*DCP*DTP*DGP*DCP*DTP*DTP*DAP*(DOC))-3'), ... | | Authors: | Wang, J, Klimenko, D, Wang, M, Steitz, T.A, Konigsberg, W.H. | | Deposit date: | 2008-03-04 | | Release date: | 2009-03-10 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Insights into base selectivity from the structures
of an RB69 DNA Polymerase triple mutant
To be Published
|
|
