9YZK
Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
Summary for 9YZK
| Entry DOI | 10.2210/pdb9yzk/pdb |
| Related | 9YZA 9YZB 9YZC 9YZD 9YZE 9YZF 9YZG 9YZI 9YZJ |
| Descriptor | Replication initiation protein, DNA (42-MER), MAGNESIUM ION, ... (4 entities in total) |
| Functional Keywords | protein-dna complex, dna binding protein, transcription factor, dna binding protein-dna complex, dna binding protein/dna |
| Biological source | Escherichia coli More |
| Total number of polymer chains | 3 |
| Total formula weight | 56634.97 |
| Authors | Shields, E.T.,Slaughter, C.K.,Magna, E.N.,Snow, C.D. (deposition date: 2025-10-30, release date: 2026-02-18) |
| Primary citation | Shields, E.T.,Slaughter, C.K.,Mekkaoui, F.,Magna, E.N.,Shepherd, C.,Lukeman, P.S.,Spratt, D.E.,Snow, C.D. Modular Scaffold Crystals for Programmable Installation and Structural Observation of DNA-Binding Proteins To Be Published, |
| Experimental method | X-RAY DIFFRACTION (5.1 Å) |
Structure validation
Download full validation report






