9YZK
Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A (C) | Replication initiation protein | polymer | 263 | 30749.1 | 1 | UniProt (P03856) | Escherichia coli | Protein E,Protein rep,Protein F4, Replication Initiator protein RepE54 |
| 2 | B (E) | DNA (42-MER) | polymer | 42 | 12706.2 | 1 | Escherichia coli | ||
| 3 | C (F) | DNA (42-MER) | polymer | 42 | 13155.4 | 1 | Escherichia coli | ||
| 4 | D (C) | MAGNESIUM ION | non-polymer | 24.3 | 1 | Chemie (MG) |
Sequence modifications
C: 1 - 251 (UniProt: P03856)
| PDB | External Database | Details |
|---|---|---|
| Met -11 | - | initiating methionine |
| Arg -10 | - | expression tag |
| Gly -9 | - | expression tag |
| Ser -8 | - | expression tag |
| His -7 | - | expression tag |
| His -6 | - | expression tag |
| His -5 | - | expression tag |
| His -4 | - | expression tag |
| His -3 | - | expression tag |
| His -2 | - | expression tag |
| Gly -1 | - | expression tag |
| Ser 0 | - | expression tag |
| Pro 118 | Arg 118 | conflict |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 3 |
| Total formula weight | 56610.7 | |
| Non-Polymers* | Number of molecules | 1 |
| Total formula weight | 24.3 | |
| All* | Total formula weight | 56635.0 |






