Loading
PDBj
MenuPDBj@FacebookPDBj@X(formerly Twitter)PDBj@BlueSkyPDBj@YouTubewwPDB FoundationwwPDBDonate
RCSB PDBPDBeBMRBAdv. SearchSearch help

6W3Q

APE1 exonuclease substrate complex L104R

Summary for 6W3Q
Entry DOI10.2210/pdb6w3q/pdb
DescriptorTCGACGGATCC, GCTGATGCG(C7R), GGATCCGTCGATCGCATCAGC, ... (7 entities in total)
Functional Keywordsnuclease, abasic site, dna repair, dna binding protein, dna binding protein-dna complex, dna binding protein/dna
Biological sourceHomo sapiens (Human)
More
Total number of polymer chains5
Total formula weight75363.62
Authors
Freudenthal, B.D.,Whitaker, A.M. (deposition date: 2020-03-09, release date: 2020-06-10, Last modification date: 2023-10-18)
Primary citationWhitaker, A.M.,Stark, W.J.,Flynn, T.S.,Freudenthal, B.D.
Molecular and structural characterization of disease-associated APE1 polymorphisms.
DNA Repair (Amst.), 91-92:102867-102867, 2020
Cited by
PubMed Abstract: Under conditions of oxidative stress, reactive oxygen species (ROS) continuously assault the structure of DNA resulting in oxidation and fragmentation of the nucleobases. When the nucleobase structure is altered, its base-pairing properties may also be altered, promoting mutations. Consequently, oxidative DNA damage is a major source of the mutation load that gives rise to numerous human maladies, including cancer. Base excision repair (BER) is the primary pathway tasked with removing and replacing mutagenic DNA base damage. Apurinic/apyrimidinic endonuclease 1 (APE1) is a central enzyme with AP-endonuclease and 3' to 5' exonuclease functions during BER, and therefore is key to maintenance of genome stability. Polymorphisms, or SNPs, in the gene encoding APE1 (APEX1) have been identified among specific human populations and result in variants of APE1 with modified function. These defects in APE1 potentially result in impaired DNA repair capabilities and consequently an increased risk of disease for individuals within these populations. In the present study, we determined the X-ray crystal structures of three prevalent disease-associated APE1 SNPs (D148E, L104R, and R237C). Each APE1 SNP results in unique localized changes in protein structure, including protein dynamics and DNA binding contacts. Combined with comprehensive biochemical characterization, including pre-steady-state kinetic and DNA binding analyses, variant APE1:DNA complex structures with both AP-endonuclease and exonuclease substrates were analyzed to elucidate how these SNPs might perturb the two major repair functions employed by APE1 during BER.
PubMed: 32454397
DOI: 10.1016/j.dnarep.2020.102867
PDB entries with the same primary citation
Experimental method
X-RAY DIFFRACTION (2.49 Å)
Structure validation

258009

PDB entries from 2026-08-12

PDB statisticsPDBj update infoContact PDBjnumon