6W3Q
APE1 exonuclease substrate complex L104R
Entity
Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
1 | A (C) | TCGACGGATCC | polymer | 11 | 3334.2 | 1 | synthetic construct | ||
2 | B (D) | GCTGATGCG(C7R) | polymer | 10 | 3077.1 | 1 | synthetic construct | ||
3 | C (E) | GGATCCGTCGATCGCATCAGC | polymer | 21 | 6424.1 | 1 | synthetic construct | ||
4 | D, E (A, B) | DNA-(apurinic or apyrimidinic site) lyase | polymer | 276 | 31232.6 | 2 | UniProt (P27695) Pfam (PF03372) | Homo sapiens (Human) | APEX nuclease,APEN,Apurinic-apyrimidinic endonuclease 1,APE-1,REF-1,Redox factor-1 |
5 | F (C) | SODIUM ION | non-polymer | 23.0 | 1 | Chemie (NA) | |||
6 | G (D) | CALCIUM ION | non-polymer | 40.1 | 1 | Chemie (CA) | |||
7 | H, I, J, K (C, D, A, B) | water | water | 18.0 | 27 | Chemie (HOH) |
Sequence modifications
A, B: 43 - 318 (UniProt: P27695)
PDB | External Database | Details |
---|---|---|
Arg 104 | Leu 104 | engineered mutation |
Sequence viewer
Contents of the asymmetric unit
Polymers | Number of chains | 5 |
Total formula weight | 75300.6 | |
Non-Polymers* | Number of molecules | 2 |
Total formula weight | 63.1 | |
All* | Total formula weight | 75363.6 |