5DS9
Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)
Summary for 5DS9
Entry DOI | 10.2210/pdb5ds9/pdb |
Related | 5DTD 5E3L 5E3M 5E3N 5E3O |
Descriptor | DNA-binding protein Fis, DNA (27-MER), ... (4 entities in total) |
Functional Keywords | protein-dna complex, hth domain, dna bending, indirect recognition, dna binding protein-dna complex, dna binding protein/dna |
Biological source | Escherichia coli (strain K12) More |
Cellular location | Cytoplasm, nucleoid : P0A6R3 |
Total number of polymer chains | 4 |
Total formula weight | 39090.65 |
Authors | Hancock, S.P.,Cascio, D.,Johnson, R.C. (deposition date: 2015-09-17, release date: 2016-07-27, Last modification date: 2023-09-27) |
Primary citation | Hancock, S.P.,Stella, S.,Cascio, D.,Johnson, R.C. DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11:e0150189-e0150189, 2016 Cited by PubMed: 26959646DOI: 10.1371/journal.pone.0150189 PDB entries with the same primary citation |
Experimental method | X-RAY DIFFRACTION (2.561 Å) |
Structure validation
Download full validation report![Download](/newweb/media/icons/dl.png)
![Download](/newweb/media/icons/dl.png)