5DS9

Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)

Experimental procedure

Experimental method	SINGLE WAVELENGTH
Source type	SYNCHROTRON
Source details	APS BEAMLINE 24-ID-C
Synchrotron site	APS
Beamline	24-ID-C
Temperature [K]	100
Detector technology	CCD
Collection date	2010-10-17
Detector	ADSC QUANTUM 315
Wavelength(s)	0.97949
Spacegroup name	P 21 21 21
Unit cell lengths	43.290, 93.950, 154.510
Unit cell angles	90.00, 90.00, 90.00

Refinement procedure

Resolution	45.162 - 2.561
R-factor	0.2243
Rwork	0.223
R-free	0.25140
Structure solution method	MOLECULAR REPLACEMENT
Starting model (for MR)	3iv5
RMSD bond length	0.017
RMSD bond angle	1.043
Data reduction software	XDS
Data scaling software	Aimless (0.5.14)
Phasing software	PHASER (2.5.2)
Refinement software	PHENIX

Data quality characteristics

	Overall	Inner shell	Outer shell
Low resolution limit [Å]	154.510	154.510	2.700
High resolution limit [Å]	2.560	8.100	2.560
Rmerge	0.067	0.045	0.690
Rpim	0.030	0.021	0.397
Total number of observations	112418	3681	7058
Number of reflections	19332
<I/σ(I)>	14.7	29.8	2.2
Completeness [%]	91.6	92.5	63.5
Redundancy	5.8	5.1	3.7
CC(1/2)	0.998	0.998	0.785

Crystallization Conditions

crystal ID	method	pH	temperature	details
1	VAPOR DIFFUSION, HANGING DROP	8.5	277	0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400