5J6U
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium
Summary for 5J6U
Entry DOI | 10.2210/pdb5j6u/pdb |
NMR Information | BMRB: 30058 |
Descriptor | DNA (25-MER) (1 entity in total) |
Functional Keywords | programmed design of g-quadruplex folding topology, structure from molmol, dna |
Biological source | synthetic construct |
Total number of polymer chains | 1 |
Total formula weight | 7978.10 |
Authors | Dvorkin, S.A.,Karsisiotis, A.I.,Webba da Silva, M. (deposition date: 2016-04-05, release date: 2017-05-10, Last modification date: 2024-06-19) |
Primary citation | Dvorkin, S.A.,Karsisiotis, A.I.,Webba da Silva, M. Encoding canonical DNA quadruplex structure. Sci Adv, 4:eaat3007-eaat3007, 2018 Cited by PubMed: 30182059DOI: 10.1126/sciadv.aat3007 PDB entries with the same primary citation |
Experimental method | SOLUTION NMR |
Structure validation
Download full validation report