1SAX
Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA
Summary for 1SAX
Entry DOI | 10.2210/pdb1sax/pdb |
Related | 1OKR |
Descriptor | 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', Methicillin resistance regulatory protein mecI, ... (5 entities in total) |
Functional Keywords | winged helix-turn-helix, transcription-dna complex, transcription/dna |
Biological source | Staphylococcus aureus subsp. aureus |
Cellular location | Cytoplasm (Probable): P68262 |
Total number of polymer chains | 4 |
Total formula weight | 45016.08 |
Authors | Garcia-Castellanos, R.,Mallorqui-Fernandez, G.,Marrero, A.,Potempa, J.,Coll, M.,Gomis-Ruth, F.X. (deposition date: 2004-02-09, release date: 2004-04-27, Last modification date: 2023-08-23) |
Primary citation | Garcia-Castellanos, R.,Mallorqui-Fernandez, G.,Marrero, A.,Potempa, J.,Coll, M.,Gomis-Ruth, F.X. On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279:17888-17896, 2004 Cited by PubMed: 14960592DOI: 10.1074/jbc.M313123200 PDB entries with the same primary citation |
Experimental method | X-RAY DIFFRACTION (2.8 Å) |
Structure validation
Download full validation report![Download](/newweb/media/icons/dl.png)
![Download](/newweb/media/icons/dl.png)