5BTI
Crystal structure of a topoisomerase II complex
Entity
Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
1 | A, C | DNA gyrase subunit A | polymer | 503 | 56225.4 | 2 | UniProt (P9WG47) Pfam (PF00521) In PDB | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) | |
2 | B, D | DNA gyrase subunit B | polymer | 253 | 28272.4 | 2 | UniProt (P9WG45) Pfam (PF01751) Pfam (PF00986) In PDB | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) | |
3 | E, H | DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA | polymer | 24 | 7417.8 | 2 | synthetic construct | ||
4 | F, G | DNA substrate 24-mer TTACGTGCATAGTCATTCATGACC | polymer | 24 | 7319.7 | 2 | synthetic construct | ||
5 | B, C, D, E | MAGNESIUM ION | non-polymer | 24.3 | 4 | Chemie (MG) | |||
6 | E, F | (3S)-9-fluoro-3-methyl-10-(4-methylpiperazin-1-yl)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid | non-polymer | 361.4 | 2 | Chemie (LFX) | |||
7 | water | water | 18.0 | 294 | Chemie (HOH) |
Sequence modifications
A, C: 2 - 500 (UniProt: P9WG47)
B, D: 426 - 675 (UniProt: P9WG45)
PDB | External Database | Details |
---|---|---|
Ser 90 | Ala 90 | engineered mutation |
Ile 501 | - | expression tag |
Gly 502 | - | expression tag |
Ser 503 | - | expression tag |
Gly 504 | - | expression tag |
PDB | External Database | Details |
---|---|---|
Ser 423 | - | expression tag |
Asn 424 | - | expression tag |
Ala 425 | - | expression tag |
Sequence viewer
Contents of the asymmetric unit
Polymers | Number of chains | 8 |
Total formula weight | 198470.8 | |
Non-Polymers* | Number of molecules | 6 |
Total formula weight | 820.0 | |
All* | Total formula weight | 199290.7 |